BBa_K1104207 1 BBa_K1104207 AhpCp1 2013-09-15T11:00:00Z 2015-05-08T01:09:09Z E. coli MG1655 genomic sequence :We improve the function of a BioBrick Part: AhpC promoter(K362001)designed by 2010 KIT-Tokyo team into four versions.On PartRegistry, the complex part(according to Ecocyc) composition contains hybrid promoters(AhpC1, AhpC2, and DsbG promoter), shared TFBS (Transcription Factor Binding Site), and reverse promoter DsbG. There is only AhpC1 promoter in this part. We designed the new part and test the promoter alone. false false _1415_ 0 16313 9 In stock false Because AhpC promoter(K362001) on PartRegistry is a hybrid promoter containing AhpC1, AhpC2, and DsbG promoter in its 1000bp, we design the new part: AhpC1 and test it apart. false Ting-Yun Chiang annotation2363189 1 -35 range2363189 1 48 53 annotation2363188 1 OxyR binding site4 range2363188 1 33 49 annotation2363187 1 OxyR binding site3 range2363187 1 11 27 annotation2363190 1 -10 range2363190 1 72 77 BBa_K1104207_sequence 1 tacgaaggttgtaaggtaaaacttatcgatttgataatggaaacgcattagccgaatcggcaaaaattggttaccttacatctcatcgaaaacacggaggaagtatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z