BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_C0053 1 c2 P22 c2 repressor from Salmonella phage P22 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Bacteriophage P22 Released HQ 2013 The P22 c2 repressor protein coding sequence is a 720 base-pair sequence with the standard RBS-compatible BioBrick prefix and the standard BioBrick suffix sections on its ends. It binds to the P22 c2 regulatory sequence, BBa_R0053. The sequence contains a LVA tag for faster degredation.</p> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Vander Byl,C. and Kropinski,A.M. <em>Sequence of the genome of Salmonella bacteriophage P22</em><br> J. Bacteriol. 182 (22), 6472-6481 (2000) <P> References (unparsed) here: <p>Vander Byl,C. and Kropinski,A.M. <em>Sequence of the genome of Salmonella bacteriophage P22</em><br> J. Bacteriol. 182 (22), 6472-6481 (2000) <P><P> true Maia Mahoney annotation2213993 1 Help:Barcodes range2213993 1 688 712 annotation1747 1 cII p22 range1747 1 1 648 annotation1751 1 stop range1751 1 682 687 annotation7036 1 BBa_C0053 range7036 1 1 687 annotation1750 1 LVA range1750 1 649 681 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_J33201 1 BBa_J33201 E. coli chromosomal ars promoter with arsR repressor gene 2006-10-12T11:00:00Z 2015-08-31T04:08:46Z The DNA was derived by PCR using genomic DNA from E. coli JM109. Primers were designed based on the sequence reported by Diorio et al (1995), J. Bacteriol 177 (8), 2050-2056, Genbank accession X80057, GI:510824. The sequence given here is derived by sequencing the biobrick construct. Released HQ 2013 This part consists of the promoter of the E. coli JM109 chromosomal arsenic detoxification operon (ars operon), including the ArsR repressor binding site and the arsR gene encoding the arsR repressor protein, together with its ribosome binding site. Addition of any other genes to the 3' end of this part will result in their expression being dependent on the presence of sodium arsenate or sodium arsenite. Arsenite or arsenite anion binds to the repressor protein ArsR, resulting in inability to repress the promoter. Based on our experiments, a concentration of 1 micromolar sodium arsenate in LB is sufficient for essentially full expression, though this will vary according to conditions. false true _63_ 0 837 63 In stock true Note that this sequence includes the arsR gene encoding the ArsR repressor protein, which is thus negatively autoregulated. No additional parts are required for arsenate-induced expression from this part. In principle, this part should also function in hosts other than E. coli. false Chris French annotation1902812 1 ArsR binding site range1902812 1 36 54 annotation1902813 1 -35 sequence range1902813 1 57 62 annotation1902814 1 -10 sequence range1902814 1 80 85 annotation1902815 1 rbs range1902815 1 108 112 annotation1902816 1 arsR range1902816 1 119 472 BBa_K1106011 1 BBa_K1106011 c2 repressor from Salmonella phage P22 (+LVA) 2013-09-20T11:00:00Z 2015-05-08T01:09:10Z This is a composite part. C2 repressor from Salmonella phage P22 (+LVA) with a strong RBS and double terminator. Phage repressor of the hybrid promoter BBa_K145150, member of the lamboid cI protein family. false false _1417_ 0 16344 9 Not in stock false We have made this construction in order to obtain a higher expression of c2 repressor. false In??s Luc??a Patop component2357557 1 BBa_B0015 component2357547 1 BBa_C0053 component2357544 1 BBa_B0030 annotation2357544 1 BBa_B0030 range2357544 1 1 15 annotation2357547 1 BBa_C0053 range2357547 1 22 708 annotation2357557 1 BBa_B0015 range2357557 1 742 870 BBa_K1106012 1 BBa_K1106012 c2 repressor from Salmonella phage P22 under ars promoter 2013-09-20T11:00:00Z 2015-05-08T01:09:10Z Composite part. c2 repressor from Salmonella phage P22 (+LVA) inducible by arsenite false false _1417_ 0 16344 9 Not in stock false None false In??s Luc??a Patop component2357580 1 BBa_K1106011 component2357564 1 BBa_J33201 annotation2357564 1 BBa_J33201 range2357564 1 1 518 annotation2357580 1 BBa_K1106011 range2357580 1 527 1396 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1106011_sequence 1 attaaagaggagaaatactagatgaatacacaattgatgggtgagcgtattcgcgctcgaagaaaaaaactcaagattagacaagccgctcttggtaagatggtgggagtgtctaatgttgcaatatcgcaatgggagcgctcggagactgagccaaatggggagaacctgttggcactttcgaaggctcttcagtgctcccctgactatttgctgaaaggagatttaagccagacaaacgttgcctatcatagtaggcatgagccaagaggatcataccctcttatcagttgggtaagcgcagggcaatggatggaagctgtagaaccttatcacaagcgcgcgatagagaactggcacgacaccactgtagattgttcagaagattcattttggcttgatgtccaaggtgactctatgacagcaccggcagggttaagcattccagaaggaatgataattctggttgatcccgaagtcgaaccaagaaacggcaagctggttgttgcaaaattagaaggtgaaaacgaggccacattcaaaaaattagttatggatgcaggccgaaagtttttaaaaccattaaacccacaatatccgatgatagaaatcaacggaaactgcaaaatcattggcgtagttgttgacgcaaaactcgcaaatcttccagctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J33201_sequence 1 ccaactcaaaattcacacctattaccttcctctgcacttacacattcgttaagtcatatatgtttttgacttatccgcttcgaagagagacactacctgcaacaatcaggagcgcaatatgtcatttctgttacccatccaattgttcaaaattcttgctgatgaaacccgtctgggcatcgttttactgctcagcgaactgggagagttatgcgtctgcgatctctgcactgctctcgaccagtcgcagcccaagatctcccgccacctggcattgctgcgtgaaagcgggctattgctggaccgcaagcaaggtaagtgggttcattaccgcttatcaccgcatattccagcatgggcggcgaaaattattgatgaggcctggcgatgtgaacaggaaaaggttcaggcgattgtccgcaacctggctcgacaaaactgttccggggacagtaagaacatttgcagttaaaaatttagctaaacacatatgaattttcagatgtgttttatccggg BBa_B0030_sequence 1 attaaagaggagaaa BBa_K1106012_sequence 1 ccaactcaaaattcacacctattaccttcctctgcacttacacattcgttaagtcatatatgtttttgacttatccgcttcgaagagagacactacctgcaacaatcaggagcgcaatatgtcatttctgttacccatccaattgttcaaaattcttgctgatgaaacccgtctgggcatcgttttactgctcagcgaactgggagagttatgcgtctgcgatctctgcactgctctcgaccagtcgcagcccaagatctcccgccacctggcattgctgcgtgaaagcgggctattgctggaccgcaagcaaggtaagtgggttcattaccgcttatcaccgcatattccagcatgggcggcgaaaattattgatgaggcctggcgatgtgaacaggaaaaggttcaggcgattgtccgcaacctggctcgacaaaactgttccggggacagtaagaacatttgcagttaaaaatttagctaaacacatatgaattttcagatgtgttttatccgggtactagagattaaagaggagaaatactagatgaatacacaattgatgggtgagcgtattcgcgctcgaagaaaaaaactcaagattagacaagccgctcttggtaagatggtgggagtgtctaatgttgcaatatcgcaatgggagcgctcggagactgagccaaatggggagaacctgttggcactttcgaaggctcttcagtgctcccctgactatttgctgaaaggagatttaagccagacaaacgttgcctatcatagtaggcatgagccaagaggatcataccctcttatcagttgggtaagcgcagggcaatggatggaagctgtagaaccttatcacaagcgcgcgatagagaactggcacgacaccactgtagattgttcagaagattcattttggcttgatgtccaaggtgactctatgacagcaccggcagggttaagcattccagaaggaatgataattctggttgatcccgaagtcgaaccaagaaacggcaagctggttgttgcaaaattagaaggtgaaaacgaggccacattcaaaaaattagttatggatgcaggccgaaagtttttaaaaccattaaacccacaatatccgatgatagaaatcaacggaaactgcaaaatcattggcgtagttgttgacgcaaaactcgcaaatcttccagctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_C0053_sequence 1 atgaatacacaattgatgggtgagcgtattcgcgctcgaagaaaaaaactcaagattagacaagccgctcttggtaagatggtgggagtgtctaatgttgcaatatcgcaatgggagcgctcggagactgagccaaatggggagaacctgttggcactttcgaaggctcttcagtgctcccctgactatttgctgaaaggagatttaagccagacaaacgttgcctatcatagtaggcatgagccaagaggatcataccctcttatcagttgggtaagcgcagggcaatggatggaagctgtagaaccttatcacaagcgcgcgatagagaactggcacgacaccactgtagattgttcagaagattcattttggcttgatgtccaaggtgactctatgacagcaccggcagggttaagcattccagaaggaatgataattctggttgatcccgaagtcgaaccaagaaacggcaagctggttgttgcaaaattagaaggtgaaaacgaggccacattcaaaaaattagttatggatgcaggccgaaagtttttaaaaccattaaacccacaatatccgatgatagaaatcaacggaaactgcaaaatcattggcgtagttgttgacgcaaaactcgcaaatcttccagctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z