BBa_K1109001 1 BBa_K1109001 LqsR promoter 2013-09-22T11:00:00Z 2015-05-08T01:09:10Z Legionella pneumophila genomic lqs gene cluster was cloned into pNT-1 plasmid(Cellular Microbiology 9(12):2903-2920, 2007.) LqsR promoter region was amplified by PCR as a biobrick. LqsR is the gene encoding response regulator component of the legionella quorum sensing (lqs). LqsR promoter region is controlled by its own response regulator LqsR. false false _1420_ 0 11226 9 Not in stock false This part is a new biobrick with prefix and suffix regeions. false Dr. ??zlem Darcansoy &#304;&#351;eri BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1109003 1 BBa_K1109003 LqsR promoter with RBS 2013-09-22T11:00:00Z 2015-05-08T01:09:10Z Legionella pneumophila genomic lqs gene cluster was cloned into pNT-1 plasmid (Cellular Microbiology 9(12):2903-2920, 2007.) LqsR promoter region was amplified by PCR as a biobrick, and ligated with RBS (BBa_B0034). LqsR is the gene encoding response regulator component of the legionella quorum sensing (lqs). LqsR promoter region is controlled by its own response regulator LqsR. This composite part contains RBS downstream of the promoter region. When any ORF is cloned to the downstream of this composite part, it can be expressed in response to legionella auto-inducer (LAI-I). false false _1420_ 0 11226 9 It's complicated false LqsR promoter part is a new biobrick with prefix and suffix regions, and RBS (BBa_B0034) was ligated to downstream of it. false Dr. ??zlem Darcansoy &#304;&#351;eri component2358476 1 BBa_B0034 component2358474 1 BBa_K1109001 annotation2358474 1 BBa_K1109001 range2358474 1 1 266 annotation2358476 1 BBa_B0034 range2358476 1 275 286 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1109001_sequence 1 gagcaaaacgttccaaagttatatcctttctatgaacttcaaataacctgtggctccatcatcagaacctggctaacttgtgaataaagtaacatgattgtttattataaccaaattatttaggttttatattcaccgggctttttggagtaagtattcaaaataagcgctcttaaaatcaaagctcaaaattagacaagttattgaatataagtctatattattaaataagtaccttatcttagctaagaaatcaaaaaaggata BBa_K1109003_sequence 1 gagcaaaacgttccaaagttatatcctttctatgaacttcaaataacctgtggctccatcatcagaacctggctaacttgtgaataaagtaacatgattgtttattataaccaaattatttaggttttatattcaccgggctttttggagtaagtattcaaaataagcgctcttaaaatcaaagctcaaaattagacaagttattgaatataagtctatattattaaataagtaccttatcttagctaagaaatcaaaaaaggatatactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z