BBa_K1109005 1 BBa_K1109005 Anti-legionella unit 2013-09-22T11:00:00Z 2015-05-08T01:09:10Z Oligonucleotide sequence of the anti-legionella peptide was obtained from genomic sequence, and sequence of the PelB leader peptide was obtained from iGEM database. Some Staphylococcus strains produce anti-Legionella peptide. ORF for anti-legionella peptide specifically encodes for a 22 amino acid peptide. Anti-legionella unit is a biobrick for suitable suffix and prefix regions. It contains a PelB leader sequence in the upstream of the anti-legionella peptide ORF to direct the peptide outside the cell. false false _1420_ 0 11226 9 It's complicated false Anti-legionella unit is a biobrick for suitable suffix and prefix regions. It was derived from synthetic oligonucleotides by tandem hybridization reactions, and amplified by PCR. false Dr. ??zlem Darcansoy İşeri BBa_K1109005_sequence 1 atgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggccatgcaatttatcacagatcttatcaaaaaagcagtagatttcttcaaaggtttatttggtaacaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z