BBa_K1112000 1 BBa_K1112000 fadB promoter + flp-21 iRNA 2013-09-09T11:00:00Z 2015-05-08T01:09:11Z fadA promoter sequence comes from E. coli DC530 strain, whereas flp-21 gene sequence from C.elegans N2 strain was used as template for the design of the antisense RNA. This composite part consists of the antisense sequence of flp-21 transcript of C.elegans, placed under the control of the fatty acid-sensitive promoter fadA of E. coli. false false _1423_ 0 11756 9 It's complicated true Intron sequences of flp-21 gene were removed for the design of the iRNA. false Pedro Luis Dorado Morales annotation2366844 1 Terminator range2366844 1 282 344 annotation2366843 1 flp21 iRNA (antisense sequence of flp21 C. elegans mRNA) range2366843 1 82 281 annotation2366842 1 fadB promoter range2366842 1 1 81 BBa_K1112000_sequence 1 atcggcatttctttaatcttttgtttgcatatttttaacacaaaatacacacttcgactcatctggtacgaccagatcaccttatccaaatcggagaggacgaggaccgagaccacgtttcattgatccatgatcgtcttcggcaacatagtaaactctgtcactgccgggtccgaattgctccaaatatgcgttcaaaacgcggagcgcatcttcctgatcgatataaggcgctgcgaggacccacgcgagaagacacgaaagcaagatgaacagccgcatgcgtgatttctgccgagcgtgatcagatcggcatttctttaatcttttgtttgcatattttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z