BBa_K1114002 1 BBa_K1114002 The MoClo format of BBa_J23102 with AB fusion sites. 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z iGEM Distribution Kit This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of BBa_J23102 with EB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_J23102">BBa_J23102</a> page for full information on the part. </html> Summary of modifications from original part: Backbone has one added SpeI site in front of gene, BsaI sites, and 4bp fusion sites. false false _1425_ 0 17243 9 In stock false This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of BBa_J23102 with EB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_J23102">BBa_J23102</a> page for full information on the part. </html> Summary of modifications from original part: Backbone has one added SpeI site in front of gene, BsaI sites, and 4bp fusion sites. false Jake Awtry BBa_K1114002_sequence 1 ggagttgacagctagctcagtcctaggtactgtgctagctact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z