BBa_K1114011 1 BBa_K1114011 The MoClo format of BBa_J23108 with AB fusion sites. 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z iGEM Distribution Kit <partinfo> BBa_K1114011 </partinfo> <partinfo> BBa_K1114011 SequenceAndFeatures </partinfo> <html> This is the <a href=???http://2013.igem.org/Team:BostonU/MoCloChara???>MoClo</a> formatted part of BBa_J23108 with AB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_J23108">BBa_J23108</a> page for full information on the part. </html> This is a MoClo level 0 promoter with a flanking site A on the 5' side and site B on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A=GGAG; B=TACT; C=AATG; D=AGGT; E=GCTT; F = CGCT; G=TGCC; H=ACTA. Summary of modifications from original part: Backbone has one added SpeI site in front of gene, BsaI sites, and 4bp fusion sites. false false _1425_ 0 17243 9 In stock false <partinfo> BBa_K1114011 </partinfo> <partinfo> BBa_K1114011 SequenceAndFeatures </partinfo> <html> This is the <a href=???http://2013.igem.org/Team:BostonU/MoCloChara???>MoClo</a> formatted part of BBa_J23108 with AB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_J23108">BBa_J23108</a> page for full information on the part. </html> This is a MoClo level 0 promoter with a flanking site A on the 5' side and site B on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A=GGAG; B=TACT; C=AATG; D=AGGT; E=GCTT; F = CGCT; G=TGCC; H=ACTA. Summary of modifications from original part: Backbone has one added SpeI site in front of gene, BsaI sites, and 4bp fusion sites. false Jake Awtry BBa_K1114011_sequence 1 ggagctgacagctagctcagtcctaggtataatgctagctact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z