BBa_K1114027 1 BBa_K1114027 The MoClo format of BBa_R0040 with FB fusion sites. 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z iGEM Distribution Kit. ===Design Notes=== <html> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of BBa_R0040 with FB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_R0040">BBa_R0040</a> page for full information on the part. This is a Level 0 MoClo part with flanking sites A on the 5' side and site B on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href="http://parts.igem.org/Part:BBa_K783055">BBa_K783055 </a>. </html> false false _1425_ 0 17243 9 In stock false ===Design Notes=== <html> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of BBa_R0040 with FB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_R0040">BBa_R0040</a> page for full information on the part. This is a Level 0 MoClo part with flanking sites A on the 5' side and site B on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href="http://parts.igem.org/Part:BBa_K783055">BBa_K783055 </a>. </html> false Jake Awtry BBa_K1114027_sequence 1 cgcttccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z