BBa_K1114034 1 BBa_K1114034 The MoClo format of BBa_R0010 with FB fusion sites 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z iGEM Kit <html> This is the <a href=??? http://2013.igem.org/Team:BostonU/MoCloChara???>MoClo</a> formatted part of BBa_R0010 with FB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_R0079">BBa_R0010</a> page for full information on the part. </html> false false _1425_ 0 8248 9 In stock false Summary of modifications from original part: Backbone has one added SpeI site in front of gene, BsaI sites, and 4bp fusion sites. false Traci Haddock BBa_K1114034_sequence 1 cgctcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z