BBa_K1114100 1 BBa_K1114100 MoClo format of a modified version of BBa_B0030 with BC fusion sites. 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z iGEM kit This is the <a href=??? http://2013.igem.org/Team:BostonU/MoCloChara???>MoClo</a> formatted part of a modified BBa_B0030 with BC fusion sites. See the <a href="http://parts.igem.org/Part:BBa_B0030">BBa_R0010</a> page for full information on the part. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the sequence. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. This part is in a MoClo backbone that is a modified version of the pSB1C3 backbone. See <a href: http://parts.igem.org/Part:BBa_B0030???>BBA_K783058</a> Summary of modifications from original part: Backbone has one added SpeI site in front of gene, BsaI sites, and 4bp fusion sites. false false _1425_ 0 8248 9 In stock false This is the <a href=??? http://2013.igem.org/Team:BostonU/MoCloChara???>MoClo</a> formatted part of a modified BBa_B0030 with BC fusion sites. See the <a href="http://parts.igem.org/Part:BBa_B0030">BBa_R0010</a> page for full information on the part. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the sequence. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. This part is in a MoClo backbone that is a modified version of the pSB1C3 backbone. See <a href: http://parts.igem.org/Part:BBa_B0030???>BBA_K783058</a> Summary of modifications from original part: Backbone has one added SpeI site in front of gene, BsaI sites, and 4bp fusion sites. false Traci Haddock BBa_K1114100_sequence 1 tactagagattaaagaggagaaatactaaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z