BBa_K1114300 1 BBa_K1114300 This is the MoClo formatted part of BBa_B0015. 2013-09-06T11:00:00Z 2015-05-08T01:09:12Z iGEM kit This is a Level 0 MoClo part with flanking sites D on the 5' side and site E on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_ K1114407 ???>BBa_</a>. false false _1425_ 0 17246 9 In stock false This is a Level 0 MoClo part with flanking sites D on the 5' side and site E on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_ K1114407 ???>BBa_</a>. false Devina Desai annotation2361811 1 MoClo Fusion Site D range2361811 1 1 4 annotation2361813 1 BBa_B0015 range2361813 1 5 133 annotation2361812 1 MoClo Fusion Site E range2361812 1 134 137 BBa_K1114300_sequence 1 aggtccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z