BBa_K1114400 1 BBa_K1114400 This is a MoClo level 0 destination vector. 2013-09-06T11:00:00Z 2015-05-08T01:09:12Z iGEM kit This is a MoClo destination vector containing the lacZ alpha fragment for blue-white screening with fusion sites A on the 5' side and site B on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. false false _1425_ 0 17246 9 Not in stock false This is a MoClo destination vector containing the lacZ alpha fragment for blue-white screening with fusion sites A on the 5' side and site B on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. false Devina Desai annotation2361936 1 BbsI range2361936 1 27 32 annotation2361895 1 SpeI range2361895 1 535 540 annotation2361889 1 BsaI range2361889 1 528 533 annotation2361888 1 BsaI range2361888 1 14 19 annotation2361893 1 SpeI range2361893 1 7 12 annotation2361892 1 SpeI range2361892 1 1 6 annotation2361898 1 alpha fragment of lacZ range2361898 1 33 514 annotation2361897 1 MoClo Fusion Site B range2361897 1 523 526 annotation2361896 1 MoClo Fusion Site A range2361896 1 21 24 annotation2361937 1 BbsI range2361937 1 515 520 BBa_K1114400_sequence 1 actagtactagtgggtctcaggagatgtcttctgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgcaagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggaagacgttactagagacctactagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z