BBa_K1114401 1 BBa_K1114401 This is a MoClo level 0 destination vector. 2013-09-06T11:00:00Z 2015-05-08T01:09:12Z igem kit This is a MoClo destination vector containing the lacZ alpha fragment for blue-white screening with fusion sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. false false _1425_ 0 17246 9 Not in stock false This is a MoClo destination vector containing the lacZ alpha fragment for blue-white screening with fusion sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. false Devina Desai annotation2361934 1 SpeI range2361934 1 529 534 annotation2361930 1 MoClo Fusion Site B range2361930 1 15 18 annotation2361931 1 BbsI range2361931 1 21 26 annotation2361928 1 SpeI range2361928 1 1 6 annotation2361929 1 BsaI range2361929 1 8 13 annotation2361932 1 MoClo Fusion Site C range2361932 1 517 520 annotation2361933 1 BsaI range2361933 1 522 527 annotation2361927 1 BbsI range2361927 1 509 514 annotation2361935 1 alpha fragment of lacZ range2361935 1 27 508 BBa_K1114401_sequence 1 actagtgggtctcatactatgtcttctgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgcaagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggaagacgtaatgagagacctactagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z