BBa_K1114403 1 BBa_K1114403 This is a MoClo level 0 destination vector. 2013-09-06T11:00:00Z 2015-05-08T01:09:12Z iGEM kit This is a MoClo destination vector containing the lacZ alpha fragment for blue-white screening with fusion sites C on the 5' side and site D on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. false false _1425_ 0 17246 9 Not in stock false This is a MoClo destination vector containing the lacZ alpha fragment for blue-white screening with fusion sites C on the 5' side and site D on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. false Devina Desai annotation2361907 1 SpeI range2361907 1 1 6 annotation2361908 1 SpeI range2361908 1 529 534 annotation2361940 1 MoClo Fusion Site D range2361940 1 517 520 annotation2361938 1 BbsI range2361938 1 21 26 annotation2361909 1 BsaI range2361909 1 8 13 annotation2361939 1 BsaI range2361939 1 522 527 annotation2361941 1 BbsI range2361941 1 509 514 annotation2361910 1 MoClo Fusion Site C range2361910 1 15 18 annotation2361942 1 alpha fragment of lacZ range2361942 1 27 508 BBa_K1114403_sequence 1 actagtgggtctcaaatgatgtcttctgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgcaagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggaagacgtaggtagagacctactagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z