BBa_K1114405 1 BBa_K1114405 This is a MoClo level 0 destination vector. 2013-09-06T11:00:00Z 2015-05-08T01:09:12Z iGEM kit This is a MoClo destination vector containing the lacZ alpha fragment for blue-white screening with fusion sites C on the 5' side and site X on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. false false _1425_ 0 17246 9 Not in stock false This is a MoClo destination vector containing the lacZ alpha fragment for blue-white screening with fusion sites C on the 5' side and site X on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. false Devina Desai BBa_K1114405_sequence 1 actagtgggtctcaaatgatgtcttctgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgcaagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggaagacgtcgttagagacctactagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z