BBa_K1114408 1 BBa_K1114408 This is a MoClo level 0 destination vector. 2013-09-06T11:00:00Z 2015-05-08T01:09:12Z iGEM kit This is a MoClo destination vector containing the lacZ alpha fragment for blue-white screening with fusion sites D on the 5' side and site F on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. false false _1425_ 0 17246 9 Not in stock false This is a MoClo destination vector containing the lacZ alpha fragment for blue-white screening with fusion sites D on the 5' side and site F on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. false Devina Desai annotation2361973 1 BbsI range2361973 1 27 32 annotation2361970 1 SpeI range2361970 1 7 12 annotation2361976 1 MoClo Fusion Site F range2361976 1 523 526 annotation2361977 1 BbsI range2361977 1 515 520 annotation2361969 1 SpeI range2361969 1 1 6 annotation2361972 1 MoClo Fusion Site D range2361972 1 21 24 annotation2361971 1 BsaI range2361971 1 14 19 annotation2361978 1 alpha fragment of lacZ range2361978 1 33 514 annotation2361974 1 SpeI range2361974 1 535 540 annotation2361975 1 BsaI range2361975 1 528 533 BBa_K1114408_sequence 1 actagtactagtgggtctcaaggtatgtcttctgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgcaagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggaagacgtcgctagagacctactagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z