BBa_K1114420 1 BBa_K1114420 Level 1 MoClo Destination Vector with F and G fusion sites 2013-09-06T11:00:00Z 2015-05-08T01:09:12Z iGEM Distribution Kit ===Design Notes=== <html> This is a MoClo destination vector containing the lacZ alpha fragment for blue-white screening with fusion sites F on the 5' side and site G on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA; Y =TGTG. Summary of modifications from original part: Backbone is a modified version of pSB1K3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href="http://parts.igem.org/Part:pSB1K3">BBa_pSB1K3</a>. </html> ===Source=== iGEM Distribution Kit ===References=== false false _1425_ 0 17243 9 It's complicated false ===Design Notes=== <html> This is a MoClo destination vector containing the lacZ alpha fragment for blue-white screening with fusion sites F on the 5' side and site G on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA; Y =TGTG. Summary of modifications from original part: Backbone is a modified version of pSB1K3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href="http://parts.igem.org/Part:pSB1K3">BBa_pSB1K3</a>. </html> ===Source=== iGEM Distribution Kit ===References=== false Jake Awtry BBa_K1114420_sequence 1 actagtggaagacatcgctagagacctgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgcaagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcgggggtctcttgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z