BBa_K1114211 1 BBa_K1114211 E1010m_CD 2013-09-06T11:00:00Z 2015-05-08T01:09:12Z igem kit Modified BBA_E0040 converted to Moclo with one cut site eliminated in the middle of the sequence. false false _1425_ 0 13936 9 In stock false n'a false Shawn Jin annotation2361771 1 MoClo Fusion Site D range2361771 1 686 689 annotation2361770 1 MoClo Fusion Site C range2361770 1 1 4 annotation2361769 1 RFP range2361769 1 5 685 BBa_K1114500 1 BBa_K1114500 MoClo Level 1 RFP reporter with AE fusion sites 2013-09-11T11:00:00Z 2015-05-08T01:09:12Z Construct of MoClo Level 0 parts derived from iGEM Distribution Kits <html> This is a <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> Level 1 reporting device containing the Level 0 parts <a href="http://parts.igem.org/Part:BBa_K1114005">J23104_AB</a>, <a href="http://parts.igem.org/Part:BBa_K1114106:Design">BCD1_BC</a>, <a href="http://parts.igem.org/Part:BBa_K1114211">E1010m_CD</a>, and <a href="http://parts.igem.org/Part:BBa_K1114300">B0015_DE</a> within the <a href="http://parts.igem.org/Part:BBa_K1114418">DVL1_AE</a> backbone. The flanking fusion sites are A on the 5' side and E on the 3' side of the insert. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. See Level 0 pages for further information. </html> false false _1425_ 0 17243 9 It's complicated false <html> This is a <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> Level 1 reporting device containing the Level 0 parts <a href="http://parts.igem.org/Part:BBa_K1114005">J23104_AB</a>, <a href="http://parts.igem.org/Part:BBa_K1114106:Design">BCD1_BC</a>, <a href="http://parts.igem.org/Part:BBa_K1114211">E1010m_CD</a>, and <a href="http://parts.igem.org/Part:BBa_K1114300">B0015_DE</a> within the <a href="http://parts.igem.org/Part:BBa_K1114418">DVL1_AE</a> backbone. The flanking fusion sites are A on the 5' side and E on the 3' side of the insert. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. See Level 0 pages for further information. </html> false Jake Awtry component2361745 1 BBa_K1114300 component2361743 1 BBa_K1114106 component2361744 1 BBa_K1114211 component2361739 1 BBa_K1114005 annotation2361745 1 BBa_K1114300 range2361745 1 825 961 annotation2361743 1 BBa_K1114106 range2361743 1 44 135 annotation2361744 1 BBa_K1114211 range2361744 1 136 824 annotation2361739 1 BBa_K1114005 range2361739 1 1 43 BBa_K1114005 1 BBa_K1114005 The MoClo format of BBa_J23104 with AB fusion sites. 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z iGEM Distribution Kit <html> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of BBa_R0079 with EB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_R0079">BBa_R0079</a> page for full information on the part. Summary of modifications from original part: Backbone has one added SpeI site in front of gene, BsaI sites, and 4bp fusion sites. </html> false false _1425_ 0 17243 9 In stock false <html> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of BBa_R0079 with EB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_R0079">BBa_R0079</a> page for full information on the part. Summary of modifications from original part: Backbone has one added SpeI site in front of gene, BsaI sites, and 4bp fusion sites. </html> false Jake Awtry annotation2361747 1 MoClo Fusion Site B range2361747 1 40 43 annotation2361746 1 MoClo Fusion Site A range2361746 1 1 4 annotation2361748 1 BBa_J23104 range2361748 1 5 39 BBa_K1114106 1 BBa_K1114106 Bicistronic Design RBS 1, MoClo Format with BC fusion sites 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z Synthesized by Sonya Iverson <html> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of a bicistronic design ribosomal binding site 1 with BC fusion sites. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K783055???>BBa_K783055</a>. </html> false false _1425_ 0 8248 9 It's complicated false <html> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of a bicistronic design ribosomal binding site 1 with BC fusion sites. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K783055???>BBa_K783055</a>. </html> false Traci Haddock annotation2361729 1 MoClo Fusion Site B range2361729 1 1 4 annotation2361731 1 BCD1 range2361731 1 5 87 annotation2361730 1 MoClo Fusion Site C range2361730 1 88 92 BBa_K1114300 1 BBa_K1114300 This is the MoClo formatted part of BBa_B0015. 2013-09-06T11:00:00Z 2015-05-08T01:09:12Z iGEM kit This is a Level 0 MoClo part with flanking sites D on the 5' side and site E on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_ K1114407 ???>BBa_</a>. false false _1425_ 0 17246 9 In stock false This is a Level 0 MoClo part with flanking sites D on the 5' side and site E on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_ K1114407 ???>BBa_</a>. false Devina Desai annotation2361811 1 MoClo Fusion Site D range2361811 1 1 4 annotation2361813 1 BBa_B0015 range2361813 1 5 133 annotation2361812 1 MoClo Fusion Site E range2361812 1 134 137 BBa_K1114300_sequence 1 aggtccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagctt BBa_K1114005_sequence 1 ggagttgacagctagctcagtcctaggtattgtgctagctact BBa_K1114500_sequence 1 ggagttgacagctagctcagtcctaggtattgtgctagctacttactgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcacaggagactttctaatgaatgatggcttcctccgaggatgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagatggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaggatggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaggactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataaaggtaggtccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagctt BBa_K1114211_sequence 1 aatgatggcttcctccgaggatgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagatggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaggatggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaggactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataaaggt BBa_K1114106_sequence 1 tactgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcacaggagactttctaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z