BBa_K1114027 1 BBa_K1114027 The MoClo format of BBa_R0040 with FB fusion sites. 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z iGEM Distribution Kit. ===Design Notes=== <html> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of BBa_R0040 with FB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_R0040">BBa_R0040</a> page for full information on the part. This is a Level 0 MoClo part with flanking sites A on the 5' side and site B on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href="http://parts.igem.org/Part:BBa_K783055">BBa_K783055 </a>. </html> false false _1425_ 0 17243 9 In stock false ===Design Notes=== <html> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of BBa_R0040 with FB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_R0040">BBa_R0040</a> page for full information on the part. This is a Level 0 MoClo part with flanking sites A on the 5' side and site B on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href="http://parts.igem.org/Part:BBa_K783055">BBa_K783055 </a>. </html> false Jake Awtry BBa_K1114107 1 BBa_K1114107 Bicistronic Design RBS 2, MoClo Format with BC fusion sites 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z This part was cloned off a BCD template from Sonya Iverson. Sonya Iverson based her designs for her BCD2 part off of a paper published by <a href= ???http://www.nature.com/nmeth/journal/v10/n4/full/nmeth.2404.html????>Mutalik, et al.</a> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of a bicistronic design ribosomal binding site 1 with BC fusion sites. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K783055???>BBa_K783055</a>. </html> false false _1425_ 0 8248 9 In stock false This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of a bicistronic design ribosomal binding site 1 with BC fusion sites. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K783055???>BBa_K783055</a>. </html> false Traci Haddock annotation2361727 1 MoClo Fusion Site B range2361727 1 1 4 annotation2361728 1 MoClo Fusion Site C range2361728 1 89 92 annotation2361724 1 BCD2 range2361724 1 5 88 BBa_K1114510 1 BBa_K1114510 Level 1 MoClo device that expresses YFP under pTetR 2013-09-11T11:00:00Z 2015-05-08T01:09:12Z Construct of MoClo Level 0 parts derived from iGEM Distribution Kits <html> pR40B2Y_FG<br><br> This is a Level 1 <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> device that expresses YFP under the repressible promoter pTetR. It contains the Level 0 parts <a href="http://parts.igem.org/Part:BBa_K1114027">R0040_FB</a>, <a href="http://parts.igem.org/Part:BBa_K1114107:Design">BCD2_BC</a>, <a href="http://parts.igem.org/Part:BBa_K1114208">E0030_CD</a>, and <a href="http://parts.igem.org/Part:BBa_K1114301">B0015_DG</a> within the <a href="http://parts.igem.org/Part:BBa_K1114419">DVL1_EF</a> backbone. In the given sequence the internal fusion sites are incorrectly duplicated. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. See Level 0 pages for further information. </html> false false _1425_ 0 17243 9 It's complicated false <html> pR40B2Y_FG<br><br> This is a Level 1 <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> device that expresses YFP under the repressible promoter pTetR. It contains the Level 0 parts <a href="http://parts.igem.org/Part:BBa_K1114027">R0040_FB</a>, <a href="http://parts.igem.org/Part:BBa_K1114107:Design">BCD2_BC</a>, <a href="http://parts.igem.org/Part:BBa_K1114208">E0030_CD</a>, and <a href="http://parts.igem.org/Part:BBa_K1114301">B0015_DG</a> within the <a href="http://parts.igem.org/Part:BBa_K1114419">DVL1_EF</a> backbone. In the given sequence the internal fusion sites are incorrectly duplicated. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. See Level 0 pages for further information. </html> false Jake Awtry component2339346 1 BBa_K1114208 component2339345 1 BBa_K1114107 component2339344 1 BBa_K1114027 component2339347 1 BBa_K1114301 annotation2339347 1 BBa_K1114301 range2339347 1 910 1046 annotation2339344 1 BBa_K1114027 range2339344 1 1 62 annotation2339345 1 BBa_K1114107 range2339345 1 71 162 annotation2339346 1 BBa_K1114208 range2339346 1 171 901 BBa_K1114208 1 BBa_K1114208 E0030_CD, YFP Reporter 2013-09-06T11:00:00Z 2015-05-08T01:09:12Z igem kit Moclo version of BBA_E0030 false false _1425_ 0 13936 9 In stock false n'a false Shawn Jin BBa_K1114301 1 BBa_K1114301 This is MoClo formatted part of BBa_B0015 2013-09-06T11:00:00Z 2015-05-08T01:09:12Z iGEM kit This is a Level 0 MoClo part with flanking sites D on the 5' side and site G on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_ K1114409 ???>BBa_</a>. false false _1425_ 0 17246 9 In stock false This is a Level 0 MoClo part with flanking sites D on the 5' side and site G on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_ K1114409 ???>BBa_</a>. false Devina Desai annotation2362000 1 MoClo Fusion Site D range2362000 1 1 4 annotation2362002 1 BBa_B0015 range2362002 1 5 133 annotation2362001 1 MoClo Fusion Site G range2362001 1 134 137 BBa_K1114510_sequence 1 cgcttccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactacttactagagtactgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatgtactagagaatgatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataaaggttactagagaggtccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatgcc BBa_K1114208_sequence 1 aatgatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataaaggt BBa_K1114107_sequence 1 tactgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatg BBa_K1114027_sequence 1 cgcttccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactact BBa_K1114301_sequence 1 aggtccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z