BBa_K1114006 1 BBa_K1114006 The MoClo format of BBa_J23104 with EB fusion sites. 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z iGEM Distribution Kit <html> This is the <a href=???http://2013.igem.org/Team:BostonU/MoCloChara???>MoClo</a> formatted part of BBa_J23104 with EB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_J23104">BBa_J23104</a> page for full information on the part. </html> Summary of modifications from original part: Backbone has one added SpeI site in front of gene, BsaI sites, and 4bp fusion sites. false false _1425_ 0 17243 9 In stock false <html> This is the <a href=???http://2013.igem.org/Team:BostonU/MoCloChara???>MoClo</a> formatted part of BBa_J23104 with EB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_J23104">BBa_J23104</a> page for full information on the part. </html> Summary of modifications from original part: Backbone has one added SpeI site in front of gene, BsaI sites, and 4bp fusion sites. false Jake Awtry BBa_K1114211 1 BBa_K1114211 E1010m_CD 2013-09-06T11:00:00Z 2015-05-08T01:09:12Z igem kit Modified BBA_E0040 converted to Moclo with one cut site eliminated in the middle of the sequence. false false _1425_ 0 13936 9 In stock false n'a false Shawn Jin annotation2361771 1 MoClo Fusion Site D range2361771 1 686 689 annotation2361770 1 MoClo Fusion Site C range2361770 1 1 4 annotation2361769 1 RFP range2361769 1 5 685 BBa_K1114515 1 BBa_K1114515 Level 1 MoClo device that constitutively expresse RFP 2013-09-11T11:00:00Z 2015-05-08T01:09:12Z Construct of MoClo Level 0 parts derived from iGEM Distribution Kits <html> pI134B2Rm_EF<br><br> This is a Level 1 <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> device that constitutively expresses RFP. It contains the Level 0 parts <a href="http://parts.igem.org/Part:BBa_K1114006">J23104_EB</a>, <a href="http://parts.igem.org/Part:BBa_K1114107:Design">BCD2_BC</a>, <a href="http://parts.igem.org/Part:BBa_K1114211">E1010m_CD</a>, and <a href="http://parts.igem.org/Part:BBa_K783020">B0015_DF</a> within the <a href="http://parts.igem.org/Part:BBa_K1114419">DVL1_EF</a> backbone. In the given sequence the internal fusion sites are incorrectly duplicated. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. See Level 0 pages for further information. </html> false false _1425_ 0 17243 9 It's complicated false <html> pI134B2Rm_EF<br><br> This is a Level 1 <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> device that constitutively expresses RFP. It contains the Level 0 parts <a href="http://parts.igem.org/Part:BBa_K1114006">J23104_EB</a>, <a href="http://parts.igem.org/Part:BBa_K1114107:Design">BCD2_BC</a>, <a href="http://parts.igem.org/Part:BBa_K1114211">E1010m_CD</a>, and <a href="http://parts.igem.org/Part:BBa_K783020">B0015_DF</a> within the <a href="http://parts.igem.org/Part:BBa_K1114419">DVL1_EF</a> backbone. In the given sequence the internal fusion sites are incorrectly duplicated. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. See Level 0 pages for further information. </html> false Jake Awtry component2339374 1 BBa_K1114211 component2339381 1 BBa_K783020 component2339373 1 BBa_K1114107 component2339372 1 BBa_K1114006 annotation2339374 1 BBa_K1114211 range2339374 1 152 840 annotation2339372 1 BBa_K1114006 range2339372 1 1 43 annotation2339381 1 BBa_K783020 range2339381 1 849 977 annotation2339373 1 BBa_K1114107 range2339373 1 52 143 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_K783020 1 BBa_K783020 MoClo converted version of BBa_B0015 2012-10-01T11:00:00Z 2015-05-08T01:13:20Z BBa_B0015 Released HQ 2013 This is the MoClo converted version of BBa_B0015, which is a double terminator consisting of BBa_B0010 and BBa_B0012. It has two MoClo fusion sites flanking it. false false _1038_ 0 8248 9 In stock false We had to design the proper MoClo fusion sites to flank this part. false Traci Haddock component2214216 1 BBa_B0010 component2214218 1 BBa_B0012 annotation2214218 1 BBa_B0012 range2214218 1 89 129 annotation2214216 1 BBa_B0010 range2214216 1 1 80 BBa_K1114107 1 BBa_K1114107 Bicistronic Design RBS 2, MoClo Format with BC fusion sites 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z This part was cloned off a BCD template from Sonya Iverson. Sonya Iverson based her designs for her BCD2 part off of a paper published by <a href= ???http://www.nature.com/nmeth/journal/v10/n4/full/nmeth.2404.html????>Mutalik, et al.</a> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of a bicistronic design ribosomal binding site 1 with BC fusion sites. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K783055???>BBa_K783055</a>. </html> false false _1425_ 0 8248 9 In stock false This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of a bicistronic design ribosomal binding site 1 with BC fusion sites. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K783055???>BBa_K783055</a>. </html> false Traci Haddock annotation2361727 1 MoClo Fusion Site B range2361727 1 1 4 annotation2361728 1 MoClo Fusion Site C range2361728 1 89 92 annotation2361724 1 BCD2 range2361724 1 5 88 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1114006_sequence 1 gcttttgacagctagctcagtcctaggtattgtgctagctact BBa_K783020_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1114107_sequence 1 tactgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatg BBa_K1114515_sequence 1 gcttttgacagctagctcagtcctaggtattgtgctagctacttactagagtactgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatgtactagagaatgatggcttcctccgaggatgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagatggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaggatggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaggactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataaaggttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1114211_sequence 1 aatgatggcttcctccgaggatgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagatggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaggatggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaggactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataaaggt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z