BBa_K1114516 1 BBa_K1114516 Level 1 MoClo Device that expresses tetR under pBAD 2013-09-11T11:00:00Z 2015-05-08T01:09:12Z Construct of MoClo Level 0 parts derived from iGEM Distribution Kits <html> pI134B2C40_AE<br><br> This is a Level 1 <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> device that expresses YFP under the repressible promoter lacI. It contains the Level 0 parts <a href="http://parts.igem.org/Part:BBa_K1114005">J23104_AB</a>, <a href="http://parts.igem.org/Part:BBa_K1114107:Design">BCD2_BC</a>, <a href="http://parts.igem.org/Part:BBa_K1114202">C0040_CD</a>, and <a href="http://parts.igem.org/Part:BBa_K1114300">B0015_DE</a> within the <a href="http://parts.igem.org/Part:BBa_K1114418">DVL1_AE</a> backbone. In the given sequence the internal fusion sites are incorrectly duplicated. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. See Level 0 pages for further information. </html> false false _1425_ 0 17243 9 It's complicated false <html> pI134B2C40_AE<br><br> This is a Level 1 <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> device that expresses YFP under the repressible promoter lacI. It contains the Level 0 parts <a href="http://parts.igem.org/Part:BBa_K1114005">J23104_AB</a>, <a href="http://parts.igem.org/Part:BBa_K1114107:Design">BCD2_BC</a>, <a href="http://parts.igem.org/Part:BBa_K1114202">C0040_CD</a>, and <a href="http://parts.igem.org/Part:BBA_K1114300">B0015_DE</a> within the <a href="http://parts.igem.org/Part:BBa_K1114418">DVL1_AE</a> backbone. In the given sequence the internal fusion sites are incorrectly duplicated. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. See Level 0 pages for further information. </html> false Jake Awtry component2339368 1 BBa_K1114202 component2339369 1 BBa_K1114300 component2339366 1 BBa_K1114005 component2339367 1 BBa_K1114107 annotation2339366 1 BBa_K1114005 range2339366 1 1 43 annotation2339367 1 BBa_K1114107 range2339367 1 52 143 annotation2339369 1 BBa_K1114300 range2339369 1 825 961 annotation2339368 1 BBa_K1114202 range2339368 1 152 816 BBa_K1114300 1 BBa_K1114300 This is the MoClo formatted part of BBa_B0015. 2013-09-06T11:00:00Z 2015-05-08T01:09:12Z iGEM kit This is a Level 0 MoClo part with flanking sites D on the 5' side and site E on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_ K1114407 ???>BBa_</a>. false false _1425_ 0 17246 9 In stock false This is a Level 0 MoClo part with flanking sites D on the 5' side and site E on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_ K1114407 ???>BBa_</a>. false Devina Desai annotation2361813 1 BBa_B0015 range2361813 1 5 133 annotation2361811 1 MoClo Fusion Site D range2361811 1 1 4 annotation2361812 1 MoClo Fusion Site E range2361812 1 134 137 BBa_K1114202 1 BBa_K1114202 C0040_CD, Moclo of BBA_C0040 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z igem kit Moclo analogue of bba_c0040 with C and D fusion sites added false false _1425_ 0 13936 9 In stock false n/a false Shawn Jin BBa_K1114107 1 BBa_K1114107 Bicistronic Design RBS 2, MoClo Format with BC fusion sites 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z This part was cloned off a BCD template from Sonya Iverson. Sonya Iverson based her designs for her BCD2 part off of a paper published by <a href= ???http://www.nature.com/nmeth/journal/v10/n4/full/nmeth.2404.html????>Mutalik, et al.</a> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of a bicistronic design ribosomal binding site 1 with BC fusion sites. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K783055???>BBa_K783055</a>. </html> false false _1425_ 0 8248 9 In stock false This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of a bicistronic design ribosomal binding site 1 with BC fusion sites. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K783055???>BBa_K783055</a>. </html> false Traci Haddock annotation2361724 1 BCD2 range2361724 1 5 88 annotation2361727 1 MoClo Fusion Site B range2361727 1 1 4 annotation2361728 1 MoClo Fusion Site C range2361728 1 89 92 BBa_K1114005 1 BBa_K1114005 The MoClo format of BBa_J23104 with AB fusion sites. 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z iGEM Distribution Kit <html> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of BBa_R0079 with EB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_R0079">BBa_R0079</a> page for full information on the part. Summary of modifications from original part: Backbone has one added SpeI site in front of gene, BsaI sites, and 4bp fusion sites. </html> false false _1425_ 0 17243 9 In stock false <html> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of BBa_R0079 with EB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_R0079">BBa_R0079</a> page for full information on the part. Summary of modifications from original part: Backbone has one added SpeI site in front of gene, BsaI sites, and 4bp fusion sites. </html> false Jake Awtry annotation2361748 1 BBa_J23104 range2361748 1 5 39 annotation2361746 1 MoClo Fusion Site A range2361746 1 1 4 annotation2361747 1 MoClo Fusion Site B range2361747 1 40 43 BBa_K1114516_sequence 1 ggagttgacagctagctcagtcctaggtattgtgctagctacttactagagtactgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatgtactagagaatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataaaggttactagagaggtccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagctt BBa_K1114300_sequence 1 aggtccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagctt BBa_K1114005_sequence 1 ggagttgacagctagctcagtcctaggtattgtgctagctact BBa_K1114202_sequence 1 aatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataaaggt BBa_K1114107_sequence 1 tactgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z