BBa_K1114107 1 BBa_K1114107 Bicistronic Design RBS 2, MoClo Format with BC fusion sites 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z This part was cloned off a BCD template from Sonya Iverson. Sonya Iverson based her designs for her BCD2 part off of a paper published by <a href= ???http://www.nature.com/nmeth/journal/v10/n4/full/nmeth.2404.html????>Mutalik, et al.</a> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of a bicistronic design ribosomal binding site 1 with BC fusion sites. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K783055???>BBa_K783055</a>. </html> false false _1425_ 0 8248 9 In stock false This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of a bicistronic design ribosomal binding site 1 with BC fusion sites. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K783055???>BBa_K783055</a>. </html> false Traci Haddock annotation2361728 1 MoClo Fusion Site C range2361728 1 89 92 annotation2361724 1 BCD2 range2361724 1 5 88 annotation2361727 1 MoClo Fusion Site B range2361727 1 1 4 BBa_K1114035 1 BBa_K1114035 pVioA in Moclo 2013-09-12T11:00:00Z 2015-05-08T01:09:11Z HOLDEN LAB Used as QS1's promoter (Bba_K1114520) false false _1425_ 0 13936 9 Not in stock false Made primers to add AB Fusion sites. false Shawn Jin BBa_K1114520 1 BBa_K1114520 QS1 2013-09-12T11:00:00Z 2015-05-08T01:09:12Z HOLDEN LAB LuxI/LuxR analogue from Chromobacterium. This contains pVioA as promoter with RFP false false _1425_ 0 13936 9 It's complicated false We added fusion sites. false Shawn Jin component2341047 1 BBa_K1114035 component2341050 1 BBa_K1114300 component2341048 1 BBa_K1114107 component2341049 1 BBa_K1114211 annotation2341049 1 BBa_K1114211 range2341049 1 452 1140 annotation2341048 1 BBa_K1114107 range2341048 1 352 443 annotation2341047 1 BBa_K1114035 range2341047 1 1 343 annotation2341050 1 BBa_K1114300 range2341050 1 1149 1285 BBa_K1114300 1 BBa_K1114300 This is the MoClo formatted part of BBa_B0015. 2013-09-06T11:00:00Z 2015-05-08T01:09:12Z iGEM kit This is a Level 0 MoClo part with flanking sites D on the 5' side and site E on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_ K1114407 ???>BBa_</a>. false false _1425_ 0 17246 9 In stock false This is a Level 0 MoClo part with flanking sites D on the 5' side and site E on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_ K1114407 ???>BBa_</a>. false Devina Desai annotation2361813 1 BBa_B0015 range2361813 1 5 133 annotation2361812 1 MoClo Fusion Site E range2361812 1 134 137 annotation2361811 1 MoClo Fusion Site D range2361811 1 1 4 BBa_K1114211 1 BBa_K1114211 E1010m_CD 2013-09-06T11:00:00Z 2015-05-08T01:09:12Z igem kit Modified BBA_E0040 converted to Moclo with one cut site eliminated in the middle of the sequence. false false _1425_ 0 13936 9 In stock false n'a false Shawn Jin annotation2361771 1 MoClo Fusion Site D range2361771 1 686 689 annotation2361770 1 MoClo Fusion Site C range2361770 1 1 4 annotation2361769 1 RFP range2361769 1 5 685 BBa_K1114300_sequence 1 aggtccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagctt BBa_K1114107_sequence 1 tactgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatg BBa_K1114035_sequence 1 atgaagacgtggagcatcgcgaatgtccttttgactagtcaactcacgcccgccgcgcggcaacggcggacgggcatgggcggcgaaaacctacggcactcgcgccttggaatcgggatgctgcctttcgtttcctcgtcatgcccggtcaatccgggcacaaaaaatcgtttgacattttattttaacaataaaatgcttttgtaatttcaagccacattagttcaaccggactcattcatcaaccatattgtctgacaatgtggctaatactgttccaagggtcagggcatgacgtggagaattggatacaaaagccaagcaatcccacgaagacctagta BBa_K1114211_sequence 1 aatgatggcttcctccgaggatgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagatggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaggatggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaggactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataaaggt BBa_K1114520_sequence 1 atgaagacgtggagcatcgcgaatgtccttttgactagtcaactcacgcccgccgcgcggcaacggcggacgggcatgggcggcgaaaacctacggcactcgcgccttggaatcgggatgctgcctttcgtttcctcgtcatgcccggtcaatccgggcacaaaaaatcgtttgacattttattttaacaataaaatgcttttgtaatttcaagccacattagttcaaccggactcattcatcaaccatattgtctgacaatgtggctaatactgttccaagggtcagggcatgacgtggagaattggatacaaaagccaagcaatcccacgaagacctagtatactagagtactgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatgtactagagaatgatggcttcctccgaggatgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagatggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaggatggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaggactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataaaggttactagagaggtccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z