BBa_K1114205 1 BBa_K1114205 CviI_CD 2013-09-06T11:00:00Z 2015-05-08T01:09:12Z Holden Lab CviI of CviI/CviR system converted into Moclo for E. Coli false false _1425_ 0 13936 9 It's complicated false n'a false Shawn Jin BBa_K1114301 1 BBa_K1114301 This is MoClo formatted part of BBa_B0015 2013-09-06T11:00:00Z 2015-05-08T01:09:12Z iGEM kit This is a Level 0 MoClo part with flanking sites D on the 5' side and site G on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_ K1114409 ???>BBa_</a>. false false _1425_ 0 17246 9 In stock false This is a Level 0 MoClo part with flanking sites D on the 5' side and site G on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_ K1114409 ???>BBa_</a>. false Devina Desai annotation2362002 1 BBa_B0015 range2362002 1 5 133 annotation2362000 1 MoClo Fusion Site D range2362000 1 1 4 annotation2362001 1 MoClo Fusion Site G range2362001 1 134 137 BBa_K1114522 1 BBa_K1114522 QS3 2013-09-12T11:00:00Z 2015-05-08T01:09:12Z HOLDEN LAB, DENSMORE LAB Third Transcriptional Unit of the CviI/CviR for MoClo false false _1425_ 0 13936 9 It's complicated false I13453_FB-BCD2-CivI-B0015 flanked by FG fusion sites in a KAN Backbone. false Shawn Jin component2341065 1 BBa_K1114301 component2341063 1 BBa_K1114107 component2341064 1 BBa_K1114205 component2341062 1 BBa_K1114024 annotation2341064 1 BBa_K1114205 range2341064 1 247 908 annotation2341065 1 BBa_K1114301 range2341065 1 917 1053 annotation2341063 1 BBa_K1114107 range2341063 1 147 238 annotation2341062 1 BBa_K1114024 range2341062 1 1 138 BBa_K1114024 1 BBa_K1114024 MoClo version of I13453 with FB fusion sites 2013-09-11T11:00:00Z 2015-05-08T01:09:11Z iGEM Distribution Kit <html> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of BBa_I13453 with FB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_I13453">BBa_I13453</a> page for full information on the part. This is a MoClo part fusion sites F on the 5' side and site B on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K1114412???></a>. </html> false false _1425_ 0 8248 9 In stock false <html> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of BBa_I13453 with FB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_I13453">BBa_I13453</a> page for full information on the part. This is a MoClo part fusion sites F on the 5' side and site B on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K1114412???></a>. </html> false Traci Haddock BBa_K1114107 1 BBa_K1114107 Bicistronic Design RBS 2, MoClo Format with BC fusion sites 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z This part was cloned off a BCD template from Sonya Iverson. Sonya Iverson based her designs for her BCD2 part off of a paper published by <a href= ???http://www.nature.com/nmeth/journal/v10/n4/full/nmeth.2404.html????>Mutalik, et al.</a> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of a bicistronic design ribosomal binding site 1 with BC fusion sites. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K783055???>BBa_K783055</a>. </html> false false _1425_ 0 8248 9 In stock false This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of a bicistronic design ribosomal binding site 1 with BC fusion sites. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K783055???>BBa_K783055</a>. </html> false Traci Haddock annotation2361728 1 MoClo Fusion Site C range2361728 1 89 92 annotation2361727 1 MoClo Fusion Site B range2361727 1 1 4 annotation2361724 1 BCD2 range2361724 1 5 88 BBa_K1114107_sequence 1 tactgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatg BBa_K1114522_sequence 1 cgctacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctacttactagagtactgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatgtactagagaatgatgaaagatttttttccgctgcaacaaggtggactggtactggagtgggtcaatactgaaactaagctgcgacagttgtgggcgttccgtcacagaatcttccgggaacagctgcagtgggtgcccttatgcgaggacggtttcgatcgggacgcatacgatgatttttccgacaacttggtattgtgccgggatggcgaggtcgtcggcgcgatacggttgactaccggagagcatcctttcatgttggaggaagagttctcgcgcttgctggcgccgggcgagcggataggcaagggggcggaatattcggaaatcacccgactggccgtggacagggaagcgctgggcgcgcgcgagtccatcatggcggccagattgctctatctgggcgcgtggctgtggtcccaggttcagggcgtgcgctggatgtatttcgtcgtggagccggtgttttaccggcgcctggtgatgatgggcttccccatcgtgccggtaggcataccccgcccactggatggcggggtgatgtcgatgacgggcttgctggactggaggcaggcgaaaaccgagcttatccgttcactaactcgcggggtgtcatcgccaagtgcatgccaagcactatggcatgagtacgattattcgcattgaaggttactagagaggtccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatgcc BBa_K1114301_sequence 1 aggtccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatgcc BBa_K1114205_sequence 1 aatgatgaaagatttttttccgctgcaacaaggtggactggtactggagtgggtcaatactgaaactaagctgcgacagttgtgggcgttccgtcacagaatcttccgggaacagctgcagtgggtgcccttatgcgaggacggtttcgatcgggacgcatacgatgatttttccgacaacttggtattgtgccgggatggcgaggtcgtcggcgcgatacggttgactaccggagagcatcctttcatgttggaggaagagttctcgcgcttgctggcgccgggcgagcggataggcaagggggcggaatattcggaaatcacccgactggccgtggacagggaagcgctgggcgcgcgcgagtccatcatggcggccagattgctctatctgggcgcgtggctgtggtcccaggttcagggcgtgcgctggatgtatttcgtcgtggagccggtgttttaccggcgcctggtgatgatgggcttccccatcgtgccggtaggcataccccgcccactggatggcggggtgatgtcgatgacgggcttgctggactggaggcaggcgaaaaccgagcttatccgttcactaactcgcggggtgtcatcgccaagtgcatgccaagcactatggcatgagtacgattattcgcattgaaggt BBa_K1114024_sequence 1 cgctacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z