BBa_K1117009 1 BBa_K1117009 J23119-K115001 2013-09-15T11:00:00Z 2015-05-08T01:09:13Z made from an ordered series of basic parts Strong constitutive promoter :j23119 42℃ RNA thermometer: k115001 false false _1428_ 0 16377 9 It's complicated false NO false Chun Li component2346133 1 BBa_K115001 component2346126 1 BBa_J23119 annotation2346133 1 BBa_K115001 range2346133 1 44 139 annotation2346126 1 BBa_J23119 range2346126 1 1 35 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_K115001 1 BBa_K115001 RNA thermometer (ROSE) 2008-07-14T11:00:00Z 2015-05-08T01:09:27Z This sequence is taken from the Bradirhizobium Japonicum (BA000040.) as the 5'UTR (ROSE) of a heat shock protein (prfA). Released HQ 2013 This part is designed as a temperature inducible RBS. Only designed so far. false false _223_ 0 3007 9 In stock true The secondary structure is important to the function of these regions, but part of the wt secondary structure is destroyed by the scar. We've tried to alter the sequence so the predicted structure (through mfold and those kind of servers) is sort of conserved, but temperature sensitivity still has to be tested. If it doesn't work, possible solution might be the addition of a larger conserved part of the wt, which implies a small part of wt protein sequence as well. true O.M.J.A. Stassen annotation1966898 1 Biobrick-Scar-adaptation range1966898 1 74 79 annotation1966926 1 Predicted Stem Loop range1966926 1 1 15 annotation1966928 1 Predicted Stem Loop range1966928 1 39 71 annotation1966929 1 Predicted Stem Loop extending to startcodon range1966929 1 72 96 annotation1966896 1 SD range1966896 1 90 95 annotation1966927 1 Predicted Stem Loop range1966927 1 16 36 BBa_K115001_sequence 1 gccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagttcttgctccttggaggat BBa_K1117009_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagaggccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagttcttgctccttggaggat BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z