BBa_J23110 1 BBa_J23110 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1117010 1 BBa_K1117010 J23110-K115002 2013-09-15T11:00:00Z 2015-05-08T01:09:13Z made from an ordered series of basic parts Medium strength constitutive promoter :J23110 37℃ RNA thermometer: false false _1428_ 0 16377 9 It's complicated false NO false Chun Li component2346141 1 BBa_J23110 component2346146 1 BBa_K115002 annotation2346146 1 BBa_K115002 range2346146 1 44 95 annotation2346141 1 BBa_J23110 range2346141 1 1 35 BBa_K115002 1 BBa_K115002 RNA thermometer (FourU) 2008-07-14T11:00:00Z 2015-05-08T01:09:27Z Salmonella Enterica Tyhpy (CP000886.1) Released HQ 2013 Thermo sensitive small RNA (ROSE structure) which can be used as a RNA regulator. false false _223_ 0 3006 9 In stock true Part of the sequence is altered because of the scar... true Bastiaan van den Berg annotation1966897 1 rbs range1966897 1 47 52 annotation1966931 1 predicted stem-loop extending to one position before start codon range1966931 1 24 52 annotation1966930 1 stem_loop range1966930 1 1 18 annotation1966899 1 scar adaptation range1966899 1 23 28 BBa_K1117010_sequence 1 tttacggctagctcagtcctaggtacaatgctagctactagagggacaagcaatgcttgccttgaatagtaacttttgaatagtgattcaggagg BBa_J23110_sequence 1 tttacggctagctcagtcctaggtacaatgctagc BBa_K115002_sequence 1 ggacaagcaatgcttgccttgaatagtaacttttgaatagtgattcaggagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z