BBa_K1119000 1 MLS Mitochondrial Leader Sequence in RFC10 standard 2013-09-10T11:00:00Z 2015-05-08T01:09:13Z Plasmid from Invitrogen: pCMV/myc/mito (http://tools.lifetechnologies.com/content/sfs/manuals/pshooter_pcmv_man.pdf) Mitochondrial leader sequence (MLS) helps direct protein to the mitochondria. When this sequence is cloned in frame at the N-terminus of the protein, it can target the recombinant protein to the mitochondria in mammalian cells. MLS will be removed upon translocation into the mitochondrial matrix. However, at least four additional amino acids (Ile-His-Ser-Leu) on this sequence are known to be retained on the N-terminus of the protein. false false _1430_ 0 16863 9 In stock false No false Wai In Hui annotation2363256 1 Mitochondrial Leader Sequence range2363256 1 1 87 BBa_K1119000_sequence 1 atgtccgtcctgacgccgctgctgctgcggggcttgacaggctcggcccggcggctcccagtgccgcgcgccaagatccattcgttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z