BBa_K1119004 1 BBa_K1119004 Human Elongation Factor-1alpha Promoter 2013-09-10T11:00:00Z 2015-05-08T01:09:13Z Plasmid iDUET101a: http://www.addgene.org/browse/sequence_vdb/2491/ A constitutive EF-1alpha promoter to regulate gene expression in mammalian cells. false false _1430_ 0 17064 9 In stock false Not applicable. false Hyun Jung Lee annotation2338823 1 BBa_K1119004 range2338823 1 1 203 BBa_K1119004_sequence 1 cgtgaggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z