BBa_K112008 1 BBa_K112008 T4 antiholin> in BBb 2008-09-02T11:00:00Z 2015-05-08T01:09:13Z <pre> PCR bx7/bx10 on Bjh1303 (322 bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI) Product is pBca1256-K112008 ---------------------------------------- bx7 Forward biobricking of {T4 Antiholin>} ccagtGAATTCatgAGATCTatggccttaaaagcaacagcac bx10 Reverse biobricking of {T4 Antiholin>} cgttaGGATCCttcagtctccaatttaatgttc </pre> T4 antiholin gene with a start codon, without a stop codon, in BBb format. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2998 9 It's complicated true N/A false Bing Xia BBa_K112008_sequence 1 atggccttaaaagcaacagcactttttgccatgctaggattgtcatttgttttatctccatcgattgaagcgaatgtcgatcctcattttgataaatttatggaatctggtattaggcacgtttatatgctttttgaaaataaaagcgtagaatcgtctgaacaattctatagttttatgagaacgacctataaaaatgacccgtgctcttctgattttgaatgtatagagcgaggcgcggagatggcacaatcatacgctagaattatgaacattaaattggagactgaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z