BBa_K112124 1 BBa_K112124 trfA with RBS 2008-10-29T12:00:00Z 2015-05-08T01:09:14Z cloned from E. coli genome This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] <!-- Add more about the biology of this part here false false _224_ 0 3241 9 Not in stock false none false Christina Brown BBa_K112124_sequence 1 gcgaggggcggcttccgctatgtacaaccagatatttttcaccaacatccttcgtctgctcgatgagcggggcatgacgaaacatgagctgtcggagagggcaggggtttcaatttcgtttttatcagacttaaccaacggtaaggccaacccctcgttgaaggtgatggaggccattgccgacgccctggaaactcccctacctcttctcctggagtccaccgaccttgaccgcgaggcactcgcggagattgcgggtcatcctttcaagagcagcgtgccgcccggatacgaacgcatcagtgtggttttgccgtcacataaggcgtttatcgtaaagaaatggggcgacgacacccgaaaaaagctgcgtggaaggctctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z