BBa_K1122011 1 BBa_K1122011 Genabler acceptor lacZα cassette 2013-08-12T11:00:00Z 2015-05-08T01:09:14Z The lacZ'alpha cassette with outward-facing EarI sites was ordered from Life Technologies Corporation as GeneArt?? Strings??? DNA Fragments. Vector pAcceptor2 consisting of pSB1C3 with the acceptor lacZ'alpha cassette is used in Genabler assembly. false false _1433_ 0 18510 9 Not in stock true lacZ'alpha is flanked by outward-facing EarI sites to be compatible with Genabler assembly. false Lina Gasiūnaitė annotation2346884 1 lacI binding site range2346884 1 101 121 annotation2346848 1 EarI site range2346848 1 5 10 annotation2346885 1 rbs range2346885 1 128 131 annotation2346869 1 -10 range2346869 1 89 94 annotation2346886 1 lacZ' range2346886 1 139 369 annotation2346864 1 CAP binding site range2346864 1 17 54 annotation2346867 1 -35 range2346867 1 66 71 annotation2346849 1 EarI site range2346849 1 370 375 BBa_K1122011_sequence 1 gcctgaagagcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgaaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaagcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgactcttca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z