BBa_K112205 1 xis {rbs.xis!} The xis gene with native rbs site and stop codon; assembly standard 21 2008-10-20T11:00:00Z 2015-05-08T01:09:14Z pAH57 plasmid This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2048 9 It's complicated true ? false Molly Allen BBa_K112205_sequence 1 taattgcggagactttgcgatgtacttgacacttcaggagtggaacgcacgccagcgacgtccaagaagccttgaaacagttcgtcgatgggttcgggaatgcaggatattcccacctccggttaaggatggaagagagtatctgttccacgaatcagcggtaaaggttgacttaaatcgaccagtaacaggtggccttttgaagaggatcagaaatgggaagaaggcgaagtcatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z