BBa_K112228 1 BBa_K112228 {pelB>} The pelB leader without stop codon, BBb format 2008-10-20T11:00:00Z 2015-05-08T01:09:15Z Synthetic Released HQ 2013 This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2048 9 In stock false ? false Molly Allen BBa_K112228_sequence 1 atgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z