BBa_K112232 1 BBa_K112232 rbs.barstar! 2008-10-20T11:00:00Z 2015-05-08T01:09:15Z <pre> Construction of {rbs.barstar!} Biobrick Part K112232 PCR mea035/mea034 on Bacillus amyloliquefaciens gen (320 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112232 ---------------------------------------- mea035 Forward Biobricking of {rbs.barstar!} cgataGAATTCatgAGATCTcataagaaaggagccgcacatg mea034 Reverse Biobricking of {rbs.barstar!} cgttaGGATCCttaagaaagtatgatggtgatgtcgcagcc </pre> ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2998 9 It's complicated true false Bing Xia BBa_K112232_sequence 1 cataagaaaggagccgcacatgaaaaaagcagtcattaacggggaacaaatcagaagtatcagcgacctccaccagacattgaaaaaggagcttgcccttccggaatactacggtgaaaacctggacgctttatgggattgtctgaccggatgggtggagtacccgctcgttttggaatggaggcagtttgaacaaagcaagcagctgactgaaaatggcgccgagagtgtgcttcaggttttccgtgaagcgaaagcggaaggctgcgacatcaccatcatactttcttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z