BBa_K1122684 1 BBa_K1122684 Plac_LacZ_RBS (B0032) 2013-09-21T11:00:00Z 2015-05-08T01:09:15Z synthetic This part enables medium levels of IPTG induced expression of a protein in ''E. coli'' without the need to include an RBS in the cloning process. false false _1433_ 0 18014 9 In stock true none false Aleksandra Lewicka component2357875 1 BBa_J33207 component2357877 1 BBa_B0032 annotation2357875 1 BBa_J33207 range2357875 1 1 600 annotation2357877 1 BBa_B0032 range2357877 1 609 621 BBa_J33207 1 BBa_J33207 lac promoter and lacZ 2006-10-26T11:00:00Z 2015-08-31T04:08:46Z The DNA was amplified from E. coli BL21 genomic DNA using primers based on published sequence (Genbank accession J01636, gi:146575). The annotation shown here is based on that associated with this Genbank entry. The sequence shown here is derived by sequencing the construct. This part (submitted in pSB1A2) consists of the lac promoter and lacZ' gene, encoding the N-terminal 76 amino acid residues of LacZ, sufficient to complement the lacZ-delta-M15 mutation for blue-white selection on Xgal plates. A SacI site has been introduced at the 3' end, overlapping the XbaI site of the Biobrick prefix. This is designed to be used as a cloning vector for making new biobricks. PCR primers can be designed with a SacI site in one primer and an SpeI site in the other. This removes the necessity for an excessively long non-complementary tail on one primer bearing either the full biobrick prefix or suffix. The PCR product can then be digested with SacI and SpeI for insertion into this plasmid, replacing the Plac-lacZ' cassette. Recombinant plasmids will then be white on IPTG/Xgal plates, whereas any that still contain the original insert will be blue. We have used this strategy to prepare several biobricks, including BBa_J33204, which contains the xylE gene encoding catechol-2,3-dioxygenase. (For making biobricks that contain lacZ', BBa_J33204 can be used in the same way; in this case, clones with plasmids that still contain xylE will turn yellow on addition of a drop of 10 mM catechol.) false false _63_ 0 837 63 It's complicated true Note that the SacI site overlaps the SpeI site. The Biobrick prefix ends ...TCTAGAG. When this is added to the CTC at the start of the sequence shown here, the SacI site, GAGCTC, is generated. false Chris French annotation1907858 1 lacZ' range1907858 1 370 600 annotation1907854 1 SacI range1907854 1 1 3 annotation1907857 1 rbs range1907857 1 359 362 annotation1907859 1 -10 range1907859 1 320 325 annotation1907855 1 CAP binding site range1907855 1 248 285 annotation1907860 1 -35 range1907860 1 297 302 annotation1907856 1 LacI binding site range1907856 1 332 352 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 BBa_B0032_sequence 1 tcacacaggaaag BBa_J33207_sequence 1 ctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgaaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga BBa_K1122684_sequence 1 ctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgaaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgatactagagtcacacaggaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z