BBa_K1123000 1 BBa_K1123000 FNR Promoter 2013-08-30T11:00:00Z 2015-05-08T01:09:15Z Part sourced from the following study into the FNR promomoter: "Transcriptional Regulation by Tandem-Bound FNR at Escherichia coli Promoters", Barnard et al. This part is a standard FNR promoter. It has two FNR binding sites at -41.5 and at -91.5 with 0 being the transcriptional starting point of this promoter. The promoter can be used in E.coli strains to induce protein expression in anaerobic environments. It is natively used to induce metabolic processes when the E.coli bacteria enter anaerobic environments. The part can be used to express any protein sequence placed behind it. false false _1435_ 0 16850 9 In stock false To remove the EcoRI site we adapted the tail of the sequence which we had found in the above mentioned article. The EcoRI site was situated in at -132. We therefore removed the sequence from -132 to -116 and replaced it with a sequence of 4 base pairs namely: GGTA. We hoped that this adaptation would be of no influence on the efficiency of the promoter. false Ardjan van der Linden BBa_K1123000_sequence 1 ggtacccggggatcaggtaaatttgatgtacatcaaatggatcctagatcagattcgggggatcaggtaaatttgatgtacatcaaatagatcccccctcactcctgccataattctgat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z