BBa_K1123000 1 BBa_K1123000 FNR Promoter 2013-08-30T11:00:00Z 2015-05-08T01:09:15Z Part sourced from the following study into the FNR promomoter: "Transcriptional Regulation by Tandem-Bound FNR at Escherichia coli Promoters", Barnard et al. This part is a standard FNR promoter. It has two FNR binding sites at -41.5 and at -91.5 with 0 being the transcriptional starting point of this promoter. The promoter can be used in E.coli strains to induce protein expression in anaerobic environments. It is natively used to induce metabolic processes when the E.coli bacteria enter anaerobic environments. The part can be used to express any protein sequence placed behind it. false false _1435_ 0 16850 9 In stock false To remove the EcoRI site we adapted the tail of the sequence which we had found in the above mentioned article. The EcoRI site was situated in at -132. We therefore removed the sequence from -132 to -116 and replaced it with a sequence of 4 base pairs namely: GGTA. We hoped that this adaptation would be of no influence on the efficiency of the promoter. false Ardjan van der Linden BBa_K1123010 1 BBa_K1123010 Ribosoom Binding Site 2013-09-07T11:00:00Z 2015-05-08T01:09:16Z The DNA sequence for this part was obtained from the article holding the information about the FNR promotor we used: "Transcription Regulation by Tandem-Bound FNR at E.coli Promoters" by Bernard et al. This part holds the DNA sequence for the ribosoom binding site used in the large constructs by the TU-Eindhoven team in 2013. The RBS site was placed behind a FNR promoter sequence and was used to express a number of different proteins in anaerobic conditions. The protein sequence was placed immediately behind the RBS. false false _1435_ 0 16850 9 Not in stock false We did not adapt the protein DNA sequence in any way. false Ardjan van der Linden BBa_K1123005 1 BBa_K1123005 EGFP Protein Production Construct 2013-09-07T11:00:00Z 2015-05-08T01:09:15Z The composite designed was something we devised ourselves although each of the separate parts was sourced from a different area. The sources for each of the relevant parts can be found on their respective pages. This composite part has been built up from a number of separate BioBricks, the most prominent of which the FNR promotor and the EGFP Protein sequence. The FNR promotor sequence enables us to bring the EGFP protein to expression anaerobically. Almost all E.coli strains posses a form of this promotor to induce metabolic processes once the bacteria enters anaerobic regions. The EGFP protein is a frequently used fluorescent protein which we are expressing with the sole purpose of testing the protein expression under the FNR promotor. false false _1435_ 0 16850 9 In stock false No real considerations were made in the construction of this composite part. The main point of focus was the compatibility of each of the parts with each other and the E.coli bacteria. Furthermore we then had to ensure that the protein sequence was in frame with the promotor to ensure that expression would be performed correctly. false Ardjan van der Linden component2336125 1 BBa_K1123000 component2336127 1 BBa_K1123012 component2336134 1 BBa_B1006 component2336129 1 BBa_K1123011 component2336126 1 BBa_K1123010 annotation2336134 1 BBa_B1006 range2336134 1 966 1004 annotation2336127 1 BBa_K1123012 range2336127 1 143 205 annotation2336126 1 BBa_K1123010 range2336126 1 121 142 annotation2336125 1 BBa_K1123000 range2336125 1 1 120 annotation2336129 1 BBa_K1123011 range2336129 1 923 965 BBa_B1006 1 BBa_B1006 Terminator (artificial, large, %T~>90) 2006-08-30T11:00:00Z 2015-08-31T04:07:21Z modified E. coli thr terminator, replaced all A-T pairs in stem with C-G pairs Released HQ 2013 Artificial terminator, estimated %T~>90% *8bp stem, 6nt loop *Bidirectional, estimated reverse %T~>90% false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 9 residues. true Haiyao Huang annotation1898430 1 PolyA range1898430 1 32 39 annotation1898429 1 modified thr terminator range1898429 1 10 31 annotation1898428 1 B1006 range1898428 1 1 39 annotation1898431 1 PolyA range1898431 1 1 9 BBa_K1123012 1 BBa_K1123012 His-Tag and Thrombine Cleavage Site 2013-09-07T11:00:00Z 2015-05-08T01:09:16Z The DNA sequence for this part was lifted directly from the pET28-a vector. This will allow us to use this part without further adaptations. This construct contains the DNA sequence we used to provide a His-Tag and Thrombine cleavage site between our promoter and protein sequence. This will enable us to purify our protein after expression. false false _1435_ 0 16850 9 Not in stock false No adaptations were made as the part has already been optimized for E.coli use. false Ardjan van der Linden BBa_K1123011 1 BBa_K1123011 Spacer Sequence 2013-09-07T11:00:00Z 2015-05-08T01:09:16Z This part was designed by ourselves. It was constructed by using a randomising a DNA sequence. This part contains the DNA sequence for a spacer which can be placed at the end of a protein sequence. This will ensure for extra DNA base pairs between the end of the protein sequence and the terminator site. This has been done to ensure that no steric hindrance will occur from the use of the terminator. false false _1435_ 0 16850 9 Not in stock false No considerations were made. false Ardjan van der Linden BBa_K1123000_sequence 1 ggtacccggggatcaggtaaatttgatgtacatcaaatggatcctagatcagattcgggggatcaggtaaatttgatgtacatcaaatagatcccccctcactcctgccataattctgat BBa_K1123011_sequence 1 taactcgagttctacgattcaagtcgtcgattgctctctactt BBa_K1123010_sequence 1 attccaggaaagagagccatcc BBa_K1123005_sequence 1 ggtacccggggatcaggtaaatttgatgtacatcaaatggatcctagatcagattcgggggatcaggtaaatttgatgtacatcaaatagatcccccctcactcctgccataattctgatattccaggaaagagagccatccatgggtagcagccatcatcatcatcatcacagcagcggcctggtgccgcgcggcagcgctagcatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaactcgagttctacgattcaagtcgtcgattgctctctacttaaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_B1006_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_K1123012_sequence 1 atgggtagcagccatcatcatcatcatcacagcagcggcctggtgccgcgcggcagcgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z