BBa_K1123010 1 BBa_K1123010 Ribosoom Binding Site 2013-09-07T11:00:00Z 2015-05-08T01:09:16Z The DNA sequence for this part was obtained from the article holding the information about the FNR promotor we used: "Transcription Regulation by Tandem-Bound FNR at E.coli Promoters" by Bernard et al. This part holds the DNA sequence for the ribosoom binding site used in the large constructs by the TU-Eindhoven team in 2013. The RBS site was placed behind a FNR promoter sequence and was used to express a number of different proteins in anaerobic conditions. The protein sequence was placed immediately behind the RBS. false false _1435_ 0 16850 9 Not in stock false We did not adapt the protein DNA sequence in any way. false Ardjan van der Linden BBa_K1123010_sequence 1 attccaggaaagagagccatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z