BBa_K1123011 1 BBa_K1123011 Spacer Sequence 2013-09-07T11:00:00Z 2015-05-08T01:09:16Z This part was designed by ourselves. It was constructed by using a randomising a DNA sequence. This part contains the DNA sequence for a spacer which can be placed at the end of a protein sequence. This will ensure for extra DNA base pairs between the end of the protein sequence and the terminator site. This has been done to ensure that no steric hindrance will occur from the use of the terminator. false false _1435_ 0 16850 9 Not in stock false No considerations were made. false Ardjan van der Linden BBa_K1123011_sequence 1 taactcgagttctacgattcaagtcgtcgattgctctctactt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z