BBa_K1123012 1 BBa_K1123012 His-Tag and Thrombine Cleavage Site 2013-09-07T11:00:00Z 2015-05-08T01:09:16Z The DNA sequence for this part was lifted directly from the pET28-a vector. This will allow us to use this part without further adaptations. This construct contains the DNA sequence we used to provide a His-Tag and Thrombine cleavage site between our promoter and protein sequence. This will enable us to purify our protein after expression. false false _1435_ 0 16850 9 Not in stock false No adaptations were made as the part has already been optimized for E.coli use. false Ardjan van der Linden BBa_K1123012_sequence 1 atgggtagcagccatcatcatcatcatcacagcagcggcctggtgccgcgcggcagcgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z