BBa_K1123013 1 BBa_K1123013 Protamine-1-Optimized Protein Sequence 2013-08-30T11:00:00Z 2015-05-08T01:09:16Z The source for the amino acid sequence was found on www.UniProt.org. Using this amino acid sequence we were able to create an E.coli optimised version of this protein. This part contains the DNA code for an E.coli Optimized version of the Human Protamine protein. It can be placed behind any promoter and brought to expression with ease. Within the scope of our project it is being used to provide CEST contrast in MRI due to its high Arginine and Lysine content. false false _1435_ 0 16850 9 Not in stock false We did not adapt any part of the found amino acid sequence although we did optimize the codon usage for E.coli bacteria. false Ardjan van der Linden BBa_K1123013_sequence 1 gcccgttaccgctgctgtcgcagccagagccggagccgctattaccgccagcgtcaacgcagccgcagacgtaggcgccggagctgccagacccggcgtcgcgccatgcgttgctgccgcccgcgctaccgtccgcgatgtcgtcgccac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z