BBa_K1123015 1 BBa_K1123015 DNA Coding Sequence for 1PJN Protein 2013-08-30T11:00:00Z 2015-05-08T01:09:16Z The amino acid sequence for this parts was retrieved from PDB.org after a database query was performed looking for proteins with high Arginine and Lysine contents. This part contains the DNA sequence for the 1PJN protein. It can be placed behind any promoter of your choice and expressed with ease. Within the scope of our project this protein was expressed due to its high Arginine and Lysine concentration. This could then be used to provide CEST contrast within an MRI. false false _1435_ 0 16850 9 Not in stock false The protein sequence was codon optimized for expression in E.coli bacteria. We then repeated the sequence a number of times to amplify the protein. These repeats were held together using small linkage sequences of Glycine and Serine amino acids. In total the 1PJN protein sequence was repeated 5 times. false Ardjan van der Linden BBa_K1123015_sequence 1 cgtaagaaacgtaagaccgaagaggaaagcccgctgaaagataaggcgaagaaaagcaaaggcggcagcggttctggctcccgtaagaaacgtaagaccgaagaggaaagcccgctgaaagataaggcgaagaaaagcaaaggcggcagcggttctggctcccgtaagaaacgtaagaccgaagaggaaagcccgctgaaagataaggcgaagaaaagcaaaggcggcagcggttctggctcccgtaagaaacgtaagaccgaagaggaaagcccgctgaaagataaggcgaagaaaagcaaaggcggcagcggttctggctcccgtaagaaacgtaagaccgaagaggaaagcccgctgaaagataaggcgaagaaaagcaaaggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z