BBa_K112308 1 BBa_K112308 {lambda holin >}; adheres to Berkeley standard 2008-10-20T11:00:00Z 2015-05-08T01:09:16Z pSB3C6-Bjh1502 lambda holin with start and no stop codon in BBb format. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2999 9 It's complicated true <pre> PCR al0007/al0010 on pSB3C6-Bjh1502 (346bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112308 ----------------------------------------------- al0007 Forward Biobricking of lambda holin with start and no stop codon CCATAGAATTCatgAGATCTatgccagaaaaacatgacctgttgg al0010 Reverse Biobricking of lambda holin wtih start and no stop codon CGttaGGATCCttgatttctaccatcttctactccggc </pre> false Aron Lau BBa_K112308_sequence 1 atgccagaaaaacatgacctgttggccgccattctcgcggcaaaggaacaaggcatcggggcaatccttgcgtttgcaatggcgtaccttcgcggcagatataatggcggtgcgtttacaaaaacagtaatcgacgcaacgatgtgcgccattatcgcctggttcattcgtgaccttctcgacttcgccggactaagtagcaatctcgcttatataacgagcgtgtttatcggctacatcggtactgactcgattggttcgcttatcaaacgcttcgctgctaaaaaagccggagtagaagatggtagaaatcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z