BBa_K112309 1 BBa_K112309 {< lambda holin >}; adheres to Berkley standard 2008-10-20T11:00:00Z 2015-05-08T01:09:16Z pSB3C6-Bjh1502 lambda holin with no start and stop codon in BBb format. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2999 9 It's complicated true <pre> PCR al0009/al0010 on pSB3C6-Bjh1502 (343bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112309 ----------------------------------------------- al0009 Forward Biobricking of lambda holin with no start and stop codon CCATAGAATTCatgAGATCTccagaaaaacatgacctgttggcc al0010 Reverse Biobricking of lambda holin with no start and stop codon CGttaGGATCCttgatttctaccatcttctactccggc </pre> false Aron Lau BBa_K112309_sequence 1 ccagaaaaacatgacctgttggccgccattctcgcggcaaaggaacaaggcatcggggcaatccttgcgtttgcaatggcgtaccttcgcggcagatataatggcggtgcgtttacaaaaacagtaatcgacgcaacgatgtgcgccattatcgcctggttcattcgtgaccttctcgacttcgccggactaagtagcaatctcgcttatataacgagcgtgtttatcggctacatcggtactgactcgattggttcgcttatcaaacgcttcgctgctaaaaaagccggagtagaagatggtagaaatcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z