BBa_K112315 1 BBa_K112315 {< lambda antiholin >}; adheres to Berkeley standard 2008-10-20T11:00:00Z 2015-05-08T01:09:16Z pSB3C6-Bjh1503 lambda antiholin with no start and stop codons. This part is actually in BBb format. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2999 9 It's complicated true <pre> PCR al0014/al0010 on pSB3C6-Bjh1503 (349bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112315 ----------------------------------------------- al0014 Forward Biobricking of lambda antiholin with no start and stop codons CCATAGAATTCatgAGATCTaagCtgccagaaaaacatgacctg al0010 Reverse Biobricking of lambda antiholin with no start and stop codons CGttaGGATCCttgatttctaccatcttctactccggc </pre> false Aron Lau BBa_K112315_sequence 1 aagctgccagaaaaacatgacctgttggccgccattctcgcggcaaaggaacaaggcatcggggcaatccttgcgtttgcaatggcgtaccttcgcggcagatataatggcggtgcgtttacaaaaacagtaatcgacgcaacgatgtgcgccattatcgcctggttcattcgtgaccttctcgacttcgccggactaagtagcaatctcgcttatataacgagcgtgtttatcggctacatcggtactgactcgattggttcgcttatcaaacgcttcgctgctaaaaaagccggagtagaagatggtagaaatcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z