BBa_K112316 1 BBa_K112316 {a~lambda antiholin!}; adheres to Berkeley standard 2008-10-20T11:00:00Z 2015-05-08T01:09:16Z pSB3C6-Bjh1503 lambda antiholin ready for rbs addition and has stop codon. This part is actually in BBb format. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2999 9 It's complicated false <pre> PCR al0015/al0008 on pSB3C6-Bjh1503 (359bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112316 ----------------------------------------------- al0015 Forward Biobricking of lambda antiholin with spacer CCATAGAATTCatgAGATCTagacatgaagCtgccagaaaaacatgacc al0008 Reverse Biobricking of lambda antiholin with spacer CGttaGGATCCttattgatttctaccatcttctactccggc </pre> false Aron Lau BBa_K112316_sequence 1 agacatgaagctgccagaaaaacatgacctgttggccgccattctcgcggcaaaggaacaaggcatcggggcaatccttgcgtttgcaatggcgtaccttcgcggcagatataatggcggtgcgtttacaaaaacagtaatcgacgcaacgatgtgcgccattatcgcctggttcattcgtgaccttctcgacttcgccggactaagtagcaatctcgcttatataacgagcgtgtttatcggctacatcggtactgactcgattggttcgcttatcaaacgcttcgctgctaaaaaagccggagtagaagatggtagaaatcaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z