BBa_K112318 1 BBa_K112318 {< bolA promoter>} in BBb format 2008-10-20T11:00:00Z 2015-05-08T01:09:16Z MG1655 bolA promoter is a promoter where levels of expression are inversely proportional to the growth rate. To read more, go to following link [http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=402084&blobtype=pdf] This part is actually in BBb format. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2999 9 It's complicated false <pre> PCR al0017/al0018 on MG1655 (467bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112318 ----------------------------------------------- al0017 Forward Biobricking of bolA promoter CCATAGAATTCatgAGATCTtgctgtggcagtgtaatcgtc al0018 Reverse Biobricking of bolA promoter CGttaGGATCCcttctatccgctcacgtatc </pre> false Aron Lau BBa_K112318_sequence 1 tgctgtggcagtgtaatcgtcggggaaacttcaatagttgttggcggttttgcgcatcctgcaagcataaacagagcaactaacgggaagaggatttttttgaacatgttcgggctctcagagactcttaagcgtgtttggtaaaaattcccgccatcataacattgccaacggcgaggggaagtgggtaaggcatgtaaattcatcatgttgacgaaataatcgcccctggtaaaagaaacactgatgcgaggcctgtgtttcaatctttaaatcagtaaacttcatacgcttgacggaaaaaccaggacgaaacctaaatatttgttgttaagctgcaatggaaacggtaaaagcggctagtatttaaagggatggatgacatctcagcgttgtcggaggagatatttcatgatgatacgtgagcggatagaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z