BBa_K112325 1 BBa_K112325 {< S-Tag!}{< b1006 >} 2008-10-28T12:00:00Z 2015-05-08T01:09:16Z {BBa_K112704} and {BBa_K112709} {<S-Tag!}{<b1006>} ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2999 9 Not in stock false <pre> Digest (BgIII methylated) K112704 CA, (BamHI methylated) K112709 AK (BamHI/BgIII/XHoI) Product is pBjh1601CK-K112325 </pre> false Aron Lau component1994544 1 BBa_K112704 component1994546 1 BBa_K112709 component1994545 1 BBa_K112999 annotation1994544 1 BBa_K112704 range1994544 1 1 48 annotation1994546 1 BBa_K112709 range1994546 1 55 94 annotation1994545 1 BBa_K112999 range1994545 1 49 54 BBa_K112704 1 S tag <S tag! 2008-10-20T11:00:00Z 2015-05-08T01:09:18Z <pre> Construction of <S-tag! basic part K112704 Wobble PCR of dv011/dv012 (60 bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI) Product is pBca1256-K112704 ---------------------------------------- dv011 Forward Biobricking of <S-Tag! cgataGAATTCatgAGATCTaaagaaaccgctgctgctaaattcgaacgcc dv012 Reverse Biobricking of <S-Tag! cgttaGGATCCttagctgtccatgtgctggcgttcgaatttagcagc </pre> This S-tag can be added after a protein part. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] true false _224_ 0 2998 9 Discontinued false false Bing Xia BBa_K112709 1 BBa_K112709 b1006 2008-10-20T11:00:00Z 2015-05-08T01:09:18Z <pre> Construction of <b1006> basic part K112709 Wobble PCR of dv021/dv022 (66bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+66, L) Product is pBca1256-K112709 ----------------------------------------------- dv021 Forward biobricking of b1006 cgataGAATTCatgAGATCTaaaaaaaaaccccgcccctgacagggcgg dv022 Reverse biobricking of b1006 GGATCCtaaaaaaaaccccgccctgtcaggggcggggtttttt </pre> The b1006 terminator. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false true _224_ 0 2998 9 Not in stock false false Bing Xia BBa_K112999 1 scar BBb1 scar sequence 2008-10-20T11:00:00Z 2015-05-08T01:09:20Z This is the scar sequence of the BBb1 assembly scheme. For more information, refer to [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page]. false false _224_ 0 2998 9 Not in stock false false Bing Xia BBa_K112704_sequence 1 aaagaaaccgctgctgctaaattcgaacgccagcacatggacagctaa BBa_K112709_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttta BBa_K112325_sequence 1 aaagaaaccgctgctgctaaattcgaacgccagcacatggacagctaaggatctaaaaaaaaaccccgcccctgacagggcggggtttttttta BBa_K112999_sequence 1 ggatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z