BBa_K112327 1 BBa_K112327 {rbs_pelB>} {< xis>} 2008-10-28T12:00:00Z 2015-05-08T01:09:16Z K112230 AK and K112203 KC {rbs_pelB>} {< xis>} ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2999 9 Not in stock false <pre> Digest (BgIII methylated) K112230 AK, (BamHI methylated) K112203 KC (BamHI/BgIII/XHoI) Product is pBjh1601AC-K112327 </pre> false Aron Lau component1994551 1 BBa_K112999 component1994550 1 BBa_K112230 component1994552 1 BBa_K112203 annotation1994550 1 BBa_K112230 range1994550 1 1 85 annotation1994551 1 BBa_K112999 range1994551 1 86 91 annotation1994552 1 BBa_K112203 range1994552 1 92 304 BBa_K112999 1 scar BBb1 scar sequence 2008-10-20T11:00:00Z 2015-05-08T01:09:20Z This is the scar sequence of the BBb1 assembly scheme. For more information, refer to [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page]. false false _224_ 0 2998 9 Not in stock false false Bing Xia BBa_K112230 1 rbs.pelB {rbs.pelB} The pelB leader with native rbs; assembly standard 21 2008-10-20T11:00:00Z 2015-05-08T01:09:15Z Synthetic This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false true _224_ 0 2048 9 It's complicated false ? false Molly Allen BBa_K112203 1 xis domain {< xis >} The bacteriophage lambda xis gene without start or stop codons; assembly standard 21 2008-10-20T11:00:00Z 2015-05-08T01:09:14Z pAH57 plasmid This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2048 9 It's complicated true ? false Molly Allen BBa_K112327_sequence 1 ttaagaaggagatatacatatgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggccggatcttacttgacacttcaggagtggaacgcacgccagcgacgtccaagaagccttgaaacagttcgtcgatgggttcgggaatgcaggatattcccacctccggttaaggatggaagagagtatctgttccacgaatcagcggtaaaggttgacttaaatcgaccagtaacaggtggccttttgaagaggatcagaaatgggaagaaggcgaagtca BBa_K112203_sequence 1 tacttgacacttcaggagtggaacgcacgccagcgacgtccaagaagccttgaaacagttcgtcgatgggttcgggaatgcaggatattcccacctccggttaaggatggaagagagtatctgttccacgaatcagcggtaaaggttgacttaaatcgaccagtaacaggtggccttttgaagaggatcagaaatgggaagaaggcgaagtca BBa_K112230_sequence 1 ttaagaaggagatatacatatgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggcc BBa_K112999_sequence 1 ggatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z