BBa_K112999 1 scar BBb1 scar sequence 2008-10-20T11:00:00Z 2015-05-08T01:09:20Z This is the scar sequence of the BBb1 assembly scheme. For more information, refer to [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page]. false false _224_ 0 2998 9 Not in stock false false Bing Xia BBa_K112615 1 BBa_K112615 rbs.LamB pp> in BBb 2008-10-21T11:00:00Z 2015-05-08T01:09:18Z <pre> Construction of {rbs_LamB>} basic part K112615 PCR sc011/sc014 on MG1655 (126 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112605 ------------------------------------------------------ sc011 Fwd biobricking of {rbs_prepro>} cgataGAATTCatgAGATCTcaatgactcaggagatagaatg sc014 Reverse biobricking of {prepro>} ccagtGGATCCagccattgcctgagcagac </pre> This is a lambB prepro with a native rbs and start codon, but without a stop codon. It is in BBb format. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 3386 9 It's complicated false N/A false Sherine Cheung BBa_K112216 1 BBa_K112216 {< ihfA >} The ihf alpha gene without start and stop codons, BBb format 2008-10-20T11:00:00Z 2015-05-08T01:09:15Z MG1655 This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2048 9 It's complicated true ? false Molly Allen BBa_K112332 1 BBa_K112332 {rbs_lamB>} {< ihfA>} 2008-10-28T12:00:00Z 2015-05-08T01:09:16Z BBa_K112615 and BBa_K112216 {rbs_lamB>} {< ihfA>} ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2999 9 Not in stock false <pre> Digest (BgIII methylated) K112615 AK, (BamHI methylated) K112216 KC (BamHI/BgIII/XHoI) Product is pBjh1601AC-K112332 </pre> false Aron Lau component1994569 1 BBa_K112999 component1994568 1 BBa_K112615 component1994570 1 BBa_K112216 annotation1994569 1 BBa_K112999 range1994569 1 95 100 annotation1994570 1 BBa_K112216 range1994570 1 101 394 annotation1994568 1 BBa_K112615 range1994568 1 1 94 BBa_K112615_sequence 1 caatgactcaggagatagaatgatgattactctgcgcaaacttcctctggcggttgccgtcgcagcgggcgtaatgtctgctcaggcaatggct BBa_K112332_sequence 1 caatgactcaggagatagaatgatgattactctgcgcaaacttcctctggcggttgccgtcgcagcgggcgtaatgtctgctcaggcaatggctggatctgcgcttacaaaagctgaaatgtcagaatatctgtttgataagcttgggcttagcaagcgggatgccaaagaactggttgaactgtttttcgaagagatccgtcgcgctctggaaaacggcgaacaggtgaaactctctggttttggtaacttcgatctgcgtgataagaatcaacgcccgggacgtaacccgaaaacgggcgaggatattcccattacagcacggcgcgtggtgaccttcagacccgggcagaagttaaaaagccgggtcgaaaacgcttcgcccaaagacgag BBa_K112999_sequence 1 ggatct BBa_K112216_sequence 1 gcgcttacaaaagctgaaatgtcagaatatctgtttgataagcttgggcttagcaagcgggatgccaaagaactggttgaactgtttttcgaagagatccgtcgcgctctggaaaacggcgaacaggtgaaactctctggttttggtaacttcgatctgcgtgataagaatcaacgcccgggacgtaacccgaaaacgggcgaggatattcccattacagcacggcgcgtggtgaccttcagacccgggcagaagttaaaaagccgggtcgaaaacgcttcgcccaaagacgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z