BBa_K112704 1 S tag <S tag! 2008-10-20T11:00:00Z 2015-05-08T01:09:18Z <pre> Construction of <S-tag! basic part K112704 Wobble PCR of dv011/dv012 (60 bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI) Product is pBca1256-K112704 ---------------------------------------- dv011 Forward Biobricking of <S-Tag! cgataGAATTCatgAGATCTaaagaaaccgctgctgctaaattcgaacgcc dv012 Reverse Biobricking of <S-Tag! cgttaGGATCCttagctgtccatgtgctggcgttcgaatttagcagc </pre> This S-tag can be added after a protein part. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] true false _224_ 0 2998 9 Discontinued false false Bing Xia BBa_K112709 1 BBa_K112709 b1006 2008-10-20T11:00:00Z 2015-05-08T01:09:18Z <pre> Construction of <b1006> basic part K112709 Wobble PCR of dv021/dv022 (66bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+66, L) Product is pBca1256-K112709 ----------------------------------------------- dv021 Forward biobricking of b1006 cgataGAATTCatgAGATCTaaaaaaaaaccccgcccctgacagggcgg dv022 Reverse biobricking of b1006 GGATCCtaaaaaaaaccccgccctgtcaggggcggggtttttt </pre> The b1006 terminator. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false true _224_ 0 2998 9 Not in stock false false Bing Xia BBa_K112350 1 BBa_K112350 {rbs_phoApp>}{< r.BamHI>}{< S-Tag!}{< b1006>} 2008-10-28T12:00:00Z 2015-05-08T01:09:16Z BBa_K112330 and BBa_K112325 {rbs_phoApp>}{< r.BamHI>}{< S-Tag!}{< b1006>} ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2999 9 Not in stock false <pre> Digest (BgIII methylated) K112330 AC (BamHI/XhoI) Digest (BamHI methylated) K112325 CK (BgIII/XHoI) Product is pBjh1601AK-K112350 </pre> false Aron Lau component1994669 1 BBa_K112105 component1994671 1 BBa_K112704 component1994672 1 BBa_K112999 component1994667 1 BBa_K112614 component1994668 1 BBa_K112999 component1994670 1 BBa_K112999 component1994673 1 BBa_K112709 annotation1994672 1 BBa_K112999 range1994672 1 778 783 annotation1994669 1 BBa_K112105 range1994669 1 88 723 annotation1994670 1 BBa_K112999 range1994670 1 724 729 annotation1994671 1 BBa_K112704 range1994671 1 730 777 annotation1994667 1 BBa_K112614 range1994667 1 1 81 annotation1994668 1 BBa_K112999 range1994668 1 82 87 annotation1994673 1 BBa_K112709 range1994673 1 784 823 BBa_K112105 1 BBa_K112105 BamHI endonuclease without start or stop codons 2008-10-20T11:00:00Z 2015-05-08T01:09:14Z <pre> PCR mv005/mv007 on pBca9145-I716210 (670bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112104 </pre> BamHI endonuclease without start or stop codons false false _224_ 0 3023 9 Not in stock false This part is built in Biobrick version 2.0. In this format, parts are flanked by BglII and BamHI restriction sites. -------------------------------------- <pre> PCR mv005/mv007 on pBca9145-I716210 (670bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112104 ----------------------------------------------- mv005 Forward Biobricking of r.BamHI! ccataGAATTCatgAGATCTatggaagtagaaaaagagtttattactgatgaagc mv007 Reverse Biobricking of r.BamHI> cgttaGGATCCtttgttttcaactttatctttcc </pre> false Madhvi Venkatesh BBa_K112999 1 scar BBb1 scar sequence 2008-10-20T11:00:00Z 2015-05-08T01:09:20Z This is the scar sequence of the BBb1 assembly scheme. For more information, refer to [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page]. false false _224_ 0 2998 9 Not in stock false false Bing Xia BBa_K112614 1 BBa_K112614 rbs.PhoA pp> in BBb 2008-10-21T11:00:00Z 2015-05-08T01:09:18Z <pre> Construction of {rbs_PhoA>} basic part K112614 PCR sc010/sc013 on MG1655 (112 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112605 ------------------------------------------------------ sc010 Fwd biobricking of {rbs_prepro>} cgataGAATTCatgAGATCTgtacatggagaaaataaaAtgaaacaaagcac sc013 Reverse biobricking of {prepro>} ccagtGGATCCggcttttgtcacaggggtaaac </pre> This is a phoA prepro with a native rbs and start codon, but without a stop codon. It is in BBb format. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 3386 9 It's complicated false N/A false Sherine Cheung BBa_K112704_sequence 1 aaagaaaccgctgctgctaaattcgaacgccagcacatggacagctaa BBa_K112709_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttta BBa_K112105_sequence 1 gaagtagaaaaagagtttattactgatgaagcaaaagaattactatctaaagataagttaattcaacaagcatacaatgaagttaaaacatctatttgttcacctatttggccagcaacctcaaaaaccttcacgattaacaacaccgaaaagaattgtaacggtgtagtaccaattaaagaactatgttacaccttacttgaagatacatataactggtatagagaaaaaccccttgatatacttaaacttgaaaagaaaaaaggtggtccgattgatgtttataaagagttcatagaaaacagtgaacttaaacgtgtaggtatggaatttgaaacaggaaatattagttctgcccaccgttcaatgaacaaacttctattaggattaaaacatggcgaaattgatttggctattatccttatgcctattaaacaattggcctattatcttacagatcgtgttaccaatttcgaggaattagaaccttattttgaacttactgaaggacaaccatttatttttattggatttaatgctgaggcttataattctaatgtccctttaattcccaaaggttctgacggtatgtcaaaacgctcaattaagaaatggaaagataaagttgaaaacaaa BBa_K112999_sequence 1 ggatct BBa_K112614_sequence 1 gtacatggagaaaataaaatgaaacaaagcactattgcactggcactcttaccgttactgtttacccctgtgacaaaagcc BBa_K112350_sequence 1 gtacatggagaaaataaaatgaaacaaagcactattgcactggcactcttaccgttactgtttacccctgtgacaaaagccggatctgaagtagaaaaagagtttattactgatgaagcaaaagaattactatctaaagataagttaattcaacaagcatacaatgaagttaaaacatctatttgttcacctatttggccagcaacctcaaaaaccttcacgattaacaacaccgaaaagaattgtaacggtgtagtaccaattaaagaactatgttacaccttacttgaagatacatataactggtatagagaaaaaccccttgatatacttaaacttgaaaagaaaaaaggtggtccgattgatgtttataaagagttcatagaaaacagtgaacttaaacgtgtaggtatggaatttgaaacaggaaatattagttctgcccaccgttcaatgaacaaacttctattaggattaaaacatggcgaaattgatttggctattatccttatgcctattaaacaattggcctattatcttacagatcgtgttaccaatttcgaggaattagaaccttattttgaacttactgaaggacaaccatttatttttattggatttaatgctgaggcttataattctaatgtccctttaattcccaaaggttctgacggtatgtcaaaacgctcaattaagaaatggaaagataaagttgaaaacaaaggatctaaagaaaccgctgctgctaaattcgaacgccagcacatggacagctaaggatctaaaaaaaaaccccgcccctgacagggcggggtttttttta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z